View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20716_high_10 (Length: 230)
Name: NF20716_high_10
Description: NF20716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20716_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 46 - 220
Target Start/End: Complemental strand, 34547292 - 34547118
Alignment:
| Q |
46 |
aacaaataatagatatttgtttgagactgaattttgaagtgtggttggagggatcaaattaattaagctggaaaaacgtggtcccctaatggccttgcag |
145 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34547292 |
aacaaataatagatgtttgtttgagactgaattttgaagtgtagttggagggatcaaattaattaagctggaaaaacgtggtcccctaatggccttgcag |
34547193 |
T |
|
| Q |
146 |
tcatactttatgatatttaaatgtgcacttgatcttgattcttgaccaaaaactataaaggaggcctttgctact |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34547192 |
tcatactttatgatatttaaatgtgcacttgatcttgattcttgaccaaaaactataaaggaggcctttgttact |
34547118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University