View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20717_high_17 (Length: 283)

Name: NF20717_high_17
Description: NF20717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20717_high_17
NF20717_high_17
[»] chr8 (1 HSPs)
chr8 (30-235)||(18171691-18171896)
[»] chr2 (1 HSPs)
chr2 (102-223)||(6388154-6388275)
[»] chr7 (1 HSPs)
chr7 (200-236)||(42966371-42966407)


Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 30 - 235
Target Start/End: Complemental strand, 18171896 - 18171691
Alignment:
30 gataattctagtgctttactctgcatggatatgcccctttcaatttgcttttctgcctcaaaaacatgacacactattcatcatagataacattgtgaat 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18171896 gataattctagtgctttactctgcatggatatgcccctttcaatttgcttttctgcctcaaaaacatgacacactattcatcatagataacattgtgaat 18171797  T
130 ggtttctttgcaattgacatagtgatgacattctttgttgcatatcttgataaccattcttaccttcttattgatgatcataagaaaattgcaaaaaggt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18171796 ggtttctttgcaattgacatagtgatgacattctttgttgcatatcttgataaccattcttaccttcttattgatgatcataagaaaattgcaaaaaggt 18171697  T
230 acatat 235  Q
    ||||||    
18171696 acatat 18171691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 102 - 223
Target Start/End: Complemental strand, 6388275 - 6388154
Alignment:
102 actattcatcatagataacattgtgaatggtttctttgcaattgacatagtgatgacattctttgttgcatatcttgataaccattcttaccttcttatt 201  Q
    ||||||||||||||| |||||||| ||||| ||||| || || ||||| ||| | |||||||| |||||||| |  ||||  |||||||  ||||| |||    
6388275 actattcatcatagacaacattgtcaatggcttcttcgccatcgacatcgtgcttacattcttcgttgcataccacgatagtcattcttctcttctcatt 6388176  T
202 gatgatcataagaaaattgcaa 223  Q
    |||||||  |||||||||||||    
6388175 gatgatccaaagaaaattgcaa 6388154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 236
Target Start/End: Original strand, 42966371 - 42966407
Alignment:
200 ttgatgatcataagaaaattgcaaaaaggtacatatt 236  Q
    |||||||| ||||||||||||||||||||||||||||    
42966371 ttgatgatgataagaaaattgcaaaaaggtacatatt 42966407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University