View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20717_high_23 (Length: 235)
Name: NF20717_high_23
Description: NF20717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20717_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 44840249 - 44840458
Alignment:
| Q |
12 |
acatgctctaggattagaacttcgggctgaacaacccaactgtttggcagcaatgcttccacctcgattcttcgatttctttgaataagtcacccatagg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44840249 |
acatgctctaggattagaacttcgggctgaacaacccaactgtttggcagcaatgcttccacctcgattcttcgatttctttgaataagtctcccatagg |
44840348 |
T |
 |
| Q |
112 |
ccatcatcctgtcctgagcctaggttaacatcagcaataccttgaatcagctgctcattattggggtaaaattgagatacacattttccccgaaaatcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44840349 |
ccatcatcctgtcctgagcctaggttaacatcagcaataccttgaatcagctgctcattattggggtaaaattgagatacacattttccccgaaaatcat |
44840448 |
T |
 |
| Q |
212 |
tattgtggac |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
44840449 |
tattgtggac |
44840458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 82 - 201
Target Start/End: Original strand, 44852079 - 44852198
Alignment:
| Q |
82 |
ttcgatttctttgaataagtcacccataggccatcatcctgtcctgagcctaggttaacatcagcaataccttgaatcagctgctcattattggggtaaa |
181 |
Q |
| |
|
||||||||||||||||||||| ||||| | |||||||||||||| ||||||| |||||||||||||||||||||| |||||||||| | ||||| | || |
|
|
| T |
44852079 |
ttcgatttctttgaataagtctcccatggcccatcatcctgtccagagcctaagttaacatcagcaataccttgagccagctgctcagttttgggatcaa |
44852178 |
T |
 |
| Q |
182 |
attgagatacacattttccc |
201 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
44852179 |
attgagatacaccttttccc |
44852198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University