View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20719_low_2 (Length: 274)
Name: NF20719_low_2
Description: NF20719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20719_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 22 - 265
Target Start/End: Original strand, 35231729 - 35231972
Alignment:
| Q |
22 |
catgatgtagatcacaaaaaatcataaagtttatgttttctccttggtaaattgatttgcatgcattttatgatagttttaatttctgcatgttatatcg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35231729 |
catgatgtagatcacaaaaaatcataaagtttatgttttctccttggtaaattgatttgcatgcattttatgatagttttaatttctgcatgttatatcg |
35231828 |
T |
|
| Q |
122 |
aaataaattagtttctgaaataaaaatttacgacaacattatgtgtttaattattaaatttattttaacatagttatctataaccttaaataagtctttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35231829 |
aaataaattagtttctgaaataaaaatttacgacaacattatgtgtttaattattaaatttattttaacatagttatctataaccttaaataagtctttt |
35231928 |
T |
|
| Q |
222 |
ttaagggttaaataagtctttttataccactattgcagtataat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35231929 |
ttaagggttaaataagtctttttataccactattgcaatataat |
35231972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University