View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071R-Insertion-10 (Length: 217)
Name: NF2071R-Insertion-10
Description: NF2071R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071R-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 43 - 217
Target Start/End: Original strand, 3676692 - 3676871
Alignment:
| Q |
43 |
actagtttgatgatatgcctatctaaatccaaactagttgcnnnnnnncagattttaaatctgagatgttctgggtttgagctcctctaatattttt-ga |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
3676692 |
actagtttgatgatatgcctatctaaatccaaactagttgcaaaaagacagattttaaatttgagatgttctgggttcgagctcctctaatatttttgga |
3676791 |
T |
|
| Q |
142 |
gagatgt-aatataaatacatttat-agtgttcttatc-ttgactcactg-aaaaaatatgatatgcatatctcatagaa |
217 |
Q |
| |
|
| ||||| |||||||||| |||||| | |||||||| | |||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
3676792 |
gggatgtaaatataaatatatttataaatgttcttacctttgactcagtgaaaaaaatatgatatgcatatctcatagaa |
3676871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University