View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_105 (Length: 219)
Name: NF2071_high_105
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_105 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 28093126 - 28093211
Alignment:
Q |
18 |
tactgcataataccattttctggctataccatttctttataatctgtcaatcaaattatgcactgttgtgtgtgatttactgacat |
103 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28093126 |
tactgcataataccattttctggctataccatttctttataatctgtcaatcaaattatgcactgttgtgtgtgatttactgacat |
28093211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 203
Target Start/End: Original strand, 28093276 - 28093311
Alignment:
Q |
168 |
tgcgggaatctgtgttttgtgtgcgaccttatccgt |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
28093276 |
tgcgggaatctgtgttttgtgtgcgaccttatccgt |
28093311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 203
Target Start/End: Original strand, 28093368 - 28093403
Alignment:
Q |
168 |
tgcgggaatctgtgttttgtgtgcgaccttatccgt |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
28093368 |
tgcgggaatctgtgttttgtgtgcgaccttatccgt |
28093403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13891 times since January 2019
Visitors: 1144