View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_73 (Length: 265)
Name: NF2071_high_73
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_high_73 |
 |  |
|
| [»] scaffold0219 (3 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0219 (Bit Score: 174; Significance: 1e-93; HSPs: 3)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 71 - 265
Target Start/End: Complemental strand, 29311 - 29119
Alignment:
| Q |
71 |
caacaaaatgcattattatagatacattggttcgttgactactcctccttgtgatgaaaatattacttggacaattgttagagaggttagtaa-ttaatt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29311 |
caacaaaatgcattattatagatacattggttcgttgactactcctccttgtgatgaaaatattacttggacaattgttagagaggttagtaatttaatt |
29212 |
T |
 |
| Q |
170 |
taatctgcatgctcctcttaatttattaaataattagtttaattggtcacacttattattaggttagaaaattttcttttactttcttctaattta |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29211 |
taatctgcatgctcctcttaatttattaaataattagtttaattggtcacac---ttattaggttagaaaattttcttttactttcttctaattta |
29119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 118 - 265
Target Start/End: Complemental strand, 24115 - 23972
Alignment:
| Q |
118 |
cttgtgatgaaaatattacttggacaattgttagagaggttagtaattaatttaatctgcatgctcctcttaatttattaaataattagtttaattggtc |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| | | ||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
24115 |
cttgcgatgaaaatattacttggacaattgttagagaggttagtgattaatttaatttgctaggttctcttaa-ttattaaataactagtttagttggtc |
24017 |
T |
 |
| Q |
218 |
acacttattattaggttagaaaattttcttttactttcttctaattta |
265 |
Q |
| |
|
| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24016 |
a---tatttattaggttagaaaattttcttttactttcttctaattta |
23972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 24202 - 24131
Alignment:
| Q |
14 |
tactagtacaggagaagaaagatcagtgggtgtaattgatcctaggatgattcaattcaacaaaatgcatta |
85 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24202 |
tactagtacaggagaagaaagagcagttggtgtaattgatcctagggtgattcaattcaacaaaatgcatta |
24131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University