View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_66 (Length: 314)
Name: NF2071_low_66
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_low_66 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 22 - 306
Target Start/End: Complemental strand, 43429050 - 43428766
Alignment:
Q |
22 |
acgaggcgttttgatcaaacatgtacaaggttacgaaataaaatgaatagctcatacatacatgcatacatacacaaacacacggtaactgtgaatag-n |
120 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
T |
43429050 |
acgaggcattttgatcaaacatgtacaaggttacgaaataaaatgaatagctcatacatacatgcatacatacacaaacacacgttaactatgaatagaa |
43428951 |
T |
|
Q |
121 |
nnnnnntcaatgcatggaagaagaaggaaccaactcactcgatatcagaatttggagataagcgg--nnnnnnnnnttactcttgttgtttctctagtca |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||| |
|
|
T |
43428950 |
aaaaaatcaatgcatggaagaagaaggaaccaactcactcgatatcagaatttggagataagcggaaaaaaaaaaattactcttgttgtt--tcgagtca |
43428853 |
T |
|
Q |
219 |
ccagaatccaaactggtcgtgggagatttggattctctctttctactcattctatcttttcccccatccaccaagttgtattcatctc |
306 |
Q |
|
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
43428852 |
cc-gaatccaaactggtcgtgggagatttggattctctctttctactcattctatcttttcccccattcaccaagttgtattcatctc |
43428766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 22082 times since January 2019
Visitors: 1298