View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_high_30 (Length: 348)
Name: NF20721_high_30
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 8 - 332
Target Start/End: Complemental strand, 41173414 - 41173102
Alignment:
| Q |
8 |
agatgaagaagatgaatgataccttgagaaaacgaggaaaatgttggataagtgaagcgaggagcgacggcggagacaaaccagttgaaacgagaatgca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41173414 |
agatgaagaagatgaatgataccttgagaaaacgaggaaaatgatggataagtgaagcgaggagcgacggcggagacaaaccagttgaaacgagaatgca |
41173315 |
T |
 |
| Q |
108 |
atcgagcaccgccggaacggcggaaggaggaacttgatcgaagcttttggataacgaagcaaccacggaaaccattgaacctgcttctgcttcagcttct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41173314 |
atcgagcaccgccggaacggcggaaggaggaacttgatcgaagcttttggataacgaagcaaccacggaaaccattgaacctgcttctg----------- |
41173226 |
T |
 |
| Q |
208 |
gcttcggaaatcattgtattcactgttcttcgaagctgttgcgaagctcgaaaagttaaaccctaattttgagttgagttgctaaaccctgaaatgaatc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41173225 |
-cttcggaaatcattgtattcactgttcttcgaagctgttgcgaagctcgaaaagttaaaccctaattttgagttgagttgctaaaccctgaaatgaatc |
41173127 |
T |
 |
| Q |
308 |
aagcacgtgtctggattcgtctatg |
332 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41173126 |
aagcacgtgtctggattcgtctatg |
41173102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University