View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_high_37 (Length: 325)
Name: NF20721_high_37
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_high_37 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 18 - 321
Target Start/End: Complemental strand, 237614 - 237311
Alignment:
| Q |
18 |
atcatcatcttcagaaacaaccaaaaaagcaccacaagacaaataccatttagcatacataacctatttcattctcggtttcggttatttacttccatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
237614 |
atcatcatcttcagaaacaaccaaaaaagcaccacaagacaaataccatttagcatacataacctatttcatcctcggtttcggttatttacttccatgg |
237515 |
T |
 |
| Q |
118 |
aacgcattcatcacagccgttgattatttctcatatctttaccctgaagcaagcgttgatcgcatcttcgccgttgtttacatgctcgttggtctatttg |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
237514 |
aatgcattcatcacagccgttgattatttctcttatctttaccctgaagcaagcgttgatcgcatcttcgccgttgtttacatgctcgttggtctctttg |
237415 |
T |
 |
| Q |
218 |
gtcttactgtgattattctttataggcataaatctcatgcttatgttaggattaacttgggtcttgctctttttgttgtttcgttgcttcttgttccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
237414 |
gtcttactgtgattattctttataggcataaatctcatgcttatgttaggattaacttgggtcttgctctttttgttgtttcgttgctgcttgttccttt |
237315 |
T |
 |
| Q |
318 |
gatt |
321 |
Q |
| |
|
|||| |
|
|
| T |
237314 |
gatt |
237311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 112 - 185
Target Start/End: Original strand, 24846876 - 24846949
Alignment:
| Q |
112 |
ccatggaacgcattcatcacagccgttgattatttctcatatctttaccctgaagcaagcgttgatcgcatctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| | || |||||||| || ||||| |
|
|
| T |
24846876 |
ccatggaacgcattcatcacagccgttgactatttctcatatctttaccctcatgccagcgttgaccgtatctt |
24846949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University