View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_high_56 (Length: 236)
Name: NF20721_high_56
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_high_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 13271383 - 13271165
Alignment:
| Q |
3 |
ttttctagtctacaacaaaaacctctttcaagttttacatcacttctctttagctccaaatcaaaaccttctttctttcccatccatccatgtctcacaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13271383 |
ttttctagtctacaacaaaaacctctttcaagttttacatcacttctctttagctccaaatcaaaaccttctttctttcccatccatccatgtctcacaa |
13271284 |
T |
|
| Q |
103 |
gaacaacacaacctagatagtgttaaaatgagtttcaaaggatgatgaatggaataaggcaaaagatcaagaacaaaatgtgttgagagagaaatagtgc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13271283 |
gaacaacacaacctagatagtgttaaaatgagtttcaaaggatgatgaat-gaataaggcaaaagatcaagaacaaaatgtgttgagagagaaatagtgc |
13271185 |
T |
|
| Q |
203 |
taactaagagagagcttatt |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13271184 |
taactaagagagagcttatt |
13271165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University