View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_low_16 (Length: 439)
Name: NF20721_low_16
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 387; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 1 - 403
Target Start/End: Complemental strand, 43540340 - 43539939
Alignment:
| Q |
1 |
taccgtagctttttgactcccaatacaaggttggttatgttaagaatagagatgagatccagaatggcttttcctttgtccttgctctctagaatcaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540340 |
taccgtagctttttgactcccaatacaaggttggttatgttaagaatagagatgagatccagaatggcttttcctttgtccttgctctctagaatcaacg |
43540241 |
T |
 |
| Q |
101 |
tttctgcagttacctgaaagaacaagaatttagtttaattttggattatagtttttgttgatatcatcatatactttaattaccttggcttcagtgctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540240 |
tttctgcagttacctgaaagaacaagaatttagtttaattttggattatagtttttgttgatatcatcatatactttaattaccttggcttcagtgctca |
43540141 |
T |
 |
| Q |
201 |
gctggatgtacttctgcaaaagatctttcctcttattgttaacttcattcaggtaacgtcttacttgttgtggggtcagctggcttcttccaagcatccc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540140 |
gctggatgtacttctgcaaaagatctttcctcttattgttaacttcattcaggtaacgtcttacttgttgtggggtcagctggcttcttccaagcatccc |
43540041 |
T |
 |
| Q |
301 |
aactatcatattcaacattttcgccatgcacatatcattttcaaattcagctatttggatgtattctttgatacataggcatatgcacaattttgatgtt |
400 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43540040 |
aactatcatattcaacattttcaccatgcacatatcattttcaaattcagctattgggatgtattc-ttgatacataggcatatgcacaattttgatgtt |
43539942 |
T |
 |
| Q |
401 |
cat |
403 |
Q |
| |
|
||| |
|
|
| T |
43539941 |
cat |
43539939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University