View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_low_45 (Length: 267)
Name: NF20721_low_45
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 39788696 - 39788459
Alignment:
| Q |
16 |
tgtccgacaaagaacaagtttcactttgcacttgtaaaatttataagagcgaaaaaatctcttactagnnnnnnncattttcacgaggagaattttacac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39788696 |
tgtccgacaaagaacaagtttcactttgcactcgtaaaatttataagagcgaaaaaatctcttactagaaaaaaacattttcacgaggagaattttacac |
39788597 |
T |
 |
| Q |
116 |
gtgcaccagttgctctatgtgagtgactttctagagaagatagattcatccgactcttataaagattgctcatacaactgaatgacaaaccaaagtcaaa |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39788596 |
gtgcaccggttgctctatgtgagtgactttctagagaagatagattcatccgactcttataaagattgctcatacaactgaatgacaaaccaaagtcaaa |
39788497 |
T |
 |
| Q |
216 |
tccaacctatacctagcagaagacaagtcaagttcaga |
253 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
39788496 |
tccaacctatacctagcagaagataagtcaaattcaga |
39788459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University