View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_low_50 (Length: 254)
Name: NF20721_low_50
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 7 - 124
Target Start/End: Original strand, 29424864 - 29424981
Alignment:
| Q |
7 |
ttgaaattcagaaattagttagaatcttattagaagaatcttaaagagagttttataatattaaaggttaaatatgagattattggtcataaattctaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
29424864 |
ttgaaattcagaaattagttagaatcttattagaagaatcttaaagagagttttataatattaaaggttaaatatgagattattgctcataaattttaaa |
29424963 |
T |
 |
| Q |
107 |
tttcgtgcctcttaaaaa |
124 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29424964 |
tttcgtgcctcttaaaaa |
29424981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 154 - 242
Target Start/End: Original strand, 29425462 - 29425548
Alignment:
| Q |
154 |
taccactttatctaaaacaaaataaaatgtatatgcaaactttggtaggataaaaaagttctcaatttatttatgtattttattttgat |
242 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29425462 |
taccacttcatctaagacaaaataaaatgtatatgcaaactttggtaggat--caaagttctcaatttatttatgtattttattttgat |
29425548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University