View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_low_60 (Length: 218)
Name: NF20721_low_60
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_low_60 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 33048599 - 33048816
Alignment:
| Q |
1 |
atatgcatgtttacctatgtttaccaaaggtctcatttggggggtaacttttctactttttagctatatatcggcaaaattgcggggaagagttataatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33048599 |
atatgcatgtttacctatgtttaccaaaggtctcatttggggtgtaagttttctactttttagctatatatcggcaaaattgtggggaagagttataatg |
33048698 |
T |
 |
| Q |
101 |
attagtgacagaatattannnnnnnngttaaaagtaaaatttcttatagtgatagtcgccttac--nnnnnnnntacattgagagctcaacgcaaagata |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
33048699 |
attagtgacagaatatt--tttttttgttaaaagtaaaatttcttatagtgatagtcgcgttacaaaaaaaaaatacattgagagctcaacgcaaagata |
33048796 |
T |
 |
| Q |
199 |
gtaactaaaaaatacataca |
218 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33048797 |
gtaactaaaaaatacataca |
33048816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University