View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_low_61 (Length: 210)
Name: NF20721_low_61
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 24 - 201
Target Start/End: Complemental strand, 48801132 - 48800953
Alignment:
| Q |
24 |
agtctctggcttgaggaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaac--tagttcgcctatttctct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
48801132 |
agtctctggcttgaggaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaacattagttggcctatttctct |
48801033 |
T |
 |
| Q |
122 |
ttctaacttttgggtattcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgcttcatctcact |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48801032 |
ttctaacttttgggtattcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgcttcttctcact |
48800953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University