View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_low_62 (Length: 210)
Name: NF20721_low_62
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_low_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 4 - 185
Target Start/End: Complemental strand, 45830307 - 45830126
Alignment:
| Q |
4 |
gagcacagatatagtttatagtcattggttgactctaagcctctagtcattggttgcatagatatagtttatccaaggaaaaatgtaattcaaaattcag |
103 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45830307 |
gagcacatatatagtttatagtcattggttgacactaagcctctagtcattggttgcatatatatagtttatctgaggaaaaatgtaattcaaaattcag |
45830208 |
T |
 |
| Q |
104 |
agtcttttcttgtatgatttattgttgattatattcattcaagtgaaatattttaccagaaattctttatagtcaagaacac |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45830207 |
agtcttttcttgtatgatttattgttgattatattcattcaagtgaaatattttaccataaattctttatagtcaagaacac |
45830126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 89 - 185
Target Start/End: Original strand, 42557882 - 42557978
Alignment:
| Q |
89 |
taattcaaaattcagagtcttttcttgtatgatttattgttgattatattcattcaagtgaaatattttaccagaaattctttatagtcaagaacac |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42557882 |
taattcaaaattcagagtcttttcttgtattatagattgttgtttatataatttcaagtgaaatactttaccagaaattctttatagtcaagaacac |
42557978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University