View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20721_low_63 (Length: 209)
Name: NF20721_low_63
Description: NF20721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20721_low_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 24 - 192
Target Start/End: Complemental strand, 36767073 - 36766905
Alignment:
| Q |
24 |
atgatgtccacatatcatccatgcccacacctccagaagaactaggcagattccttctagaatattgcacaggaggcgcagttgatgaactcgaaatctc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36767073 |
atgatgtccacatatcatccatgcccacacctccagaagaactaggcagattccttctagaatattgcacaggaggtgcagttgatgaactcgaaatctc |
36766974 |
T |
|
| Q |
124 |
cggtcgattacgcttgaagggtgtggcctggaaattatcggttggagtttcctgtggagagttccttat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
36766973 |
tggtcgattacgcttgaagggtgtggcctggaaatgattggttggagtttcctgtggagagttccttat |
36766905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 24 - 192
Target Start/End: Complemental strand, 36748631 - 36748463
Alignment:
| Q |
24 |
atgatgtccacatatcatccatgcccacacctccagaagaactaggcagattccttctagaatattgcacaggaggcgcagttgatgaactcgaaatctc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||| ||||||||||||||||| ||| |||||||| |
|
|
| T |
36748631 |
atgatgtccacatatcatccatgcccacacctccaaaagaactagacagactccttctagaatattgcaaaggaggcgcagttgatgtacttgaaatctc |
36748532 |
T |
|
| Q |
124 |
cggtcgattacgcttgaagggtgtggcctggaaattatcggttggagtttcctgtggagagttccttat |
192 |
Q |
| |
|
|||||||| |||||||| |||||||||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
36748531 |
cggtcgatgacgcttgaggggtgtggcctgaaaataattggttggagtttcctgtggagagttccttat |
36748463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 191
Target Start/End: Complemental strand, 21138038 - 21138000
Alignment:
| Q |
153 |
ggaaattatcggttggagtttcctgtggagagttcctta |
191 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
21138038 |
ggaaattattggttggagcttcctgtggagagttcctta |
21138000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University