View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20722_high_12 (Length: 437)
Name: NF20722_high_12
Description: NF20722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20722_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 81 - 425
Target Start/End: Original strand, 22274093 - 22274437
Alignment:
| Q |
81 |
cgcttgaattttatggcataaagttgttatctctattctaacaagggaaacataaataggatcttattttttctaatttcttggagttcaggtatgcttc |
180 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||| |||||||||||||| | |
|
|
| T |
22274093 |
cgcttgaattttatggcataaagttgctatctctattctaacaaggaaaacataaatagggtcttatttttgctaatttcttgaagttcaggtatgctcc |
22274192 |
T |
 |
| Q |
181 |
atttatcgcttgtggagcaggtgaaaccgcatttggagtacatataaatatcaaccaaaatatagttcagaataatttgcgagggcataattgcaatggc |
280 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22274193 |
atttatcgcttgtggagcaagtgaaaccgcatttggaatacatataagtatcaaccaaaatatagttcagaataatttgcgagggcataattgcaatggc |
22274292 |
T |
 |
| Q |
281 |
aatgagaactctggtcaatacaatatacagttgaggtatctaatgatagccaatatagaggtacaattggtacataaaggagaaagtgatagaagcagct |
380 |
Q |
| |
|
|||||||||||| |||||| ||||||| ||||||||||| |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22274293 |
aatgagaactctagtcaatgcaatataaagttgaggtatttaatgatagccaatatagaggtccaattggtacataaaggataaagtgatagaagcagct |
22274392 |
T |
 |
| Q |
381 |
gaagttttgcaagtacattatggcattgctccaactatggtccat |
425 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22274393 |
gaagttttgcaagtatattatggcattgctccaactatggtccat |
22274437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University