View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20722_high_27 (Length: 289)
Name: NF20722_high_27
Description: NF20722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20722_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 5 - 124
Target Start/End: Original strand, 41842487 - 41842606
Alignment:
| Q |
5 |
tgtcgaagaatatgaggaagaaatcttgaaggccctcaagaaggatttagggaagcatcatgttgaggcttttagagatgaggtgtgtttctttttctac |
104 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41842487 |
tgtcaaagaaaatgaggaagaaatcttgaaggccctcaagaaggatttagggaagcatcatgttgaggcttttagagatgaggtgtgtttcttattctac |
41842586 |
T |
 |
| Q |
105 |
ttgctacactcttatagtag |
124 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41842587 |
ttgctacactcttatagtag |
41842606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 195 - 269
Target Start/End: Original strand, 41842669 - 41842743
Alignment:
| Q |
195 |
ttgcaggttggaacgttnnnnnnntccattgatttggcaataaagtccttcaaaaaatggatggctggtaaagag |
269 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41842669 |
ttgcaggttggaacgttaaaaaaatccattgatttggcaataaagtccttcaaaaaatggatggctggtaaagag |
41842743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University