View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20722_high_35 (Length: 254)
Name: NF20722_high_35
Description: NF20722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20722_high_35 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 35 - 254
Target Start/End: Complemental strand, 38772407 - 38772188
Alignment:
| Q |
35 |
ttgcatgatttggagagatagtgagagggcataactacaagttaaagtgatgagaaaataattaattcaatttttactaacaaaaattaaaatatccccg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
38772407 |
ttgcatgatttggagagatagtgagagggcataactacaagttaaagtgatgagaaaataatgaattcaatttttactaacaaaaattaaaatatccgcg |
38772308 |
T |
 |
| Q |
135 |
gactttctgtaccccctttttggacaacatttttcatatgaacttgaaaatttagtagacacaagggggtgcgaaaattactgcttgattagttcatgac |
234 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38772307 |
gactttctgta-cccctttttggacaacatttttcatatgaacttgaaaatttagtagacacaagggggtgcgaaaattactgcttgattaggtcatgac |
38772209 |
T |
 |
| Q |
235 |
aattgtc-ttgtaaggaatat |
254 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
38772208 |
aattgtctttgtaaggaatat |
38772188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University