View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20722_high_38 (Length: 229)

Name: NF20722_high_38
Description: NF20722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20722_high_38
NF20722_high_38
[»] chr2 (39 HSPs)
chr2 (7-175)||(32494441-32494609)
chr2 (174-226)||(33575750-33575802)
chr2 (170-226)||(41451831-41451887)
chr2 (176-226)||(4794130-4794180)
chr2 (168-226)||(16523275-16523333)
chr2 (175-229)||(36815782-36815836)
chr2 (169-226)||(13215053-13215110)
chr2 (173-226)||(44559059-44559112)
chr2 (174-226)||(1138309-1138361)
chr2 (174-226)||(20131315-20131367)
chr2 (174-226)||(44985934-44985986)
chr2 (175-226)||(2481192-2481243)
chr2 (175-226)||(4042609-4042660)
chr2 (175-226)||(4424135-4424186)
chr2 (175-226)||(17541726-17541777)
chr2 (175-226)||(24358895-24358946)
chr2 (175-226)||(25705084-25705135)
chr2 (175-226)||(31644840-31644891)
chr2 (175-226)||(33576067-33576118)
chr2 (172-226)||(10671891-10671945)
chr2 (172-226)||(11788366-11788420)
chr2 (165-226)||(16522979-16523041)
chr2 (176-226)||(23732039-23732089)
chr2 (176-226)||(27109073-27109123)
chr2 (176-226)||(42695868-42695918)
chr2 (181-226)||(4794423-4794468)
chr2 (176-229)||(9195054-9195107)
chr2 (177-226)||(20939275-20939324)
chr2 (178-227)||(29182391-29182440)
chr2 (173-226)||(36815485-36815538)
chr2 (177-226)||(42696153-42696202)
chr2 (174-226)||(10671628-10671680)
chr2 (174-226)||(24358614-24358666)
chr2 (174-226)||(25705399-25705451)
chr2 (174-226)||(37910754-37910806)
chr2 (174-226)||(38639410-38639462)
chr2 (174-226)||(43592044-43592096)
chr2 (178-226)||(44559359-44559407)
chr2 (170-226)||(44994011-44994067)
[»] scaffold0085 (1 HSPs)
scaffold0085 (174-226)||(35034-35086)
[»] chr8 (46 HSPs)
chr8 (170-229)||(25600224-25600283)
chr8 (174-229)||(9496339-9496394)
chr8 (175-226)||(20984460-20984511)
chr8 (172-226)||(35097324-35097378)
chr8 (172-226)||(35346948-35347002)
chr8 (176-226)||(44998213-44998263)
chr8 (169-226)||(1778557-1778614)
chr8 (173-226)||(7326083-7326136)
chr8 (173-226)||(13154883-13154936)
chr8 (172-229)||(19494115-19494172)
chr8 (173-226)||(28258191-28258244)
chr8 (177-226)||(30969399-30969448)
chr8 (174-226)||(3512216-3512268)
chr8 (174-226)||(10337117-10337169)
chr8 (179-226)||(2811731-2811778)
chr8 (175-226)||(4473994-4474045)
chr8 (175-226)||(7420229-7420280)
chr8 (175-226)||(8298925-8298976)
chr8 (175-226)||(9175011-9175062)
chr8 (175-226)||(10872914-10872965)
chr8 (175-226)||(11019519-11019570)
chr8 (175-226)||(24815018-24815069)
chr8 (175-226)||(28324131-28324182)
chr8 (175-226)||(32725906-32725957)
chr8 (176-226)||(7185954-7186004)
chr8 (176-226)||(8298587-8298637)
chr8 (178-224)||(13779151-13779197)
chr8 (176-226)||(14489023-14489073)
chr8 (175-229)||(16789074-16789128)
chr8 (175-229)||(25131110-25131164)
chr8 (176-226)||(34963614-34963664)
chr8 (176-226)||(35346629-35346679)
chr8 (176-226)||(42133104-42133154)
chr8 (173-226)||(17073804-17073857)
chr8 (173-226)||(17574413-17574466)
chr8 (173-226)||(29158351-29158404)
chr8 (174-226)||(3511904-3511956)
chr8 (174-226)||(4473702-4473754)
chr8 (174-226)||(4710170-4710222)
chr8 (174-226)||(8094791-8094843)
chr8 (174-226)||(11019807-11019859)
chr8 (174-226)||(11976686-11976738)
chr8 (174-226)||(27117751-27117803)
chr8 (174-226)||(28346708-28346760)
chr8 (174-226)||(32726221-32726273)
chr8 (176-224)||(42132864-42132912)
[»] chr3 (33 HSPs)
chr3 (174-229)||(30128282-30128337)
chr3 (172-226)||(30034422-30034476)
chr3 (173-229)||(474355-474411)
chr3 (174-226)||(15979651-15979703)
chr3 (170-229)||(45002015-45002074)
chr3 (173-226)||(9603626-9603679)
chr3 (168-229)||(30130150-30130211)
chr3 (176-229)||(43441270-43441323)
chr3 (173-226)||(47336531-47336584)
chr3 (173-226)||(54608813-54608866)
chr3 (174-226)||(12740905-12740957)
chr3 (174-226)||(28452145-28452197)
chr3 (174-226)||(29490693-29490745)
chr3 (174-226)||(46622079-46622131)
chr3 (174-226)||(51550396-51550448)
chr3 (175-226)||(474043-474094)
chr3 (179-226)||(3387268-3387315)
chr3 (175-226)||(12741221-12741272)
chr3 (175-226)||(43441553-43441604)
chr3 (176-226)||(4034717-4034767)
chr3 (167-229)||(4035000-4035062)
chr3 (174-224)||(4321944-4321994)
chr3 (176-226)||(26090028-26090078)
chr3 (172-226)||(35407740-35407794)
chr3 (173-226)||(9262105-9262158)
chr3 (174-226)||(1721087-1721139)
chr3 (174-226)||(25609765-25609817)
chr3 (174-226)||(28452326-28452378)
chr3 (174-226)||(28552333-28552385)
chr3 (174-226)||(34238596-34238648)
chr3 (175-227)||(35177254-35177306)
chr3 (174-226)||(39288848-39288900)
chr3 (174-226)||(51550080-51550132)
[»] chr4 (38 HSPs)
chr4 (173-226)||(26412187-26412240)
chr4 (172-229)||(53915994-53916051)
chr4 (174-226)||(23245545-23245597)
chr4 (175-226)||(2322382-2322433)
chr4 (171-226)||(22584282-22584337)
chr4 (175-226)||(44925484-44925535)
chr4 (173-224)||(51738134-51738185)
chr4 (172-229)||(47532619-47532675)
chr4 (175-224)||(52543421-52543470)
chr4 (174-226)||(13631226-13631278)
chr4 (174-226)||(28448832-28448884)
chr4 (174-226)||(29420487-29420539)
chr4 (174-226)||(35464016-35464068)
chr4 (174-226)||(47023055-47023107)
chr4 (173-224)||(5797772-5797823)
chr4 (175-226)||(14791756-14791807)
chr4 (175-226)||(25423923-25423974)
chr4 (175-226)||(25424262-25424313)
chr4 (175-226)||(26314282-26314333)
chr4 (175-226)||(31811924-31811975)
chr4 (175-226)||(43231087-43231138)
chr4 (179-226)||(47022743-47022790)
chr4 (175-226)||(52442042-52442093)
chr4 (172-226)||(11693071-11693125)
chr4 (176-226)||(13073759-13073809)
chr4 (172-226)||(13530375-13530429)
chr4 (177-226)||(2322094-2322143)
chr4 (173-226)||(9289263-9289316)
chr4 (174-223)||(12152446-12152495)
chr4 (175-224)||(28449166-28449215)
chr4 (174-226)||(4279020-4279072)
chr4 (174-226)||(13479561-13479613)
chr4 (174-226)||(14488137-14488189)
chr4 (178-226)||(19903605-19903653)
chr4 (170-226)||(29380860-29380916)
chr4 (178-226)||(35420653-35420701)
chr4 (174-226)||(42823774-42823826)
chr4 (174-226)||(46088010-46088062)
[»] chr7 (36 HSPs)
chr7 (175-226)||(5234154-5234205)
chr7 (175-226)||(44568640-44568691)
chr7 (173-226)||(1614556-1614609)
chr7 (175-224)||(34878077-34878126)
chr7 (174-226)||(25988383-25988435)
chr7 (174-226)||(35665875-35665927)
chr7 (174-226)||(35838287-35838339)
chr7 (174-226)||(46759656-46759708)
chr7 (175-226)||(8144294-8144345)
chr7 (174-229)||(22539928-22539983)
chr7 (175-226)||(23399926-23399977)
chr7 (175-226)||(25092159-25092210)
chr7 (175-226)||(26877677-26877728)
chr7 (175-226)||(27458398-27458449)
chr7 (175-226)||(35837923-35837974)
chr7 (175-226)||(39520397-39520448)
chr7 (175-226)||(44958456-44958507)
chr7 (171-226)||(48192438-48192493)
chr7 (172-226)||(9659351-9659405)
chr7 (176-226)||(24717482-24717532)
chr7 (168-226)||(26878021-26878079)
chr7 (176-226)||(35469880-35469930)
chr7 (176-226)||(41364884-41364934)
chr7 (176-226)||(44403199-44403249)
chr7 (176-226)||(46829262-46829312)
chr7 (173-226)||(23676402-23676455)
chr7 (171-228)||(25547248-25547305)
chr7 (173-226)||(29198300-29198353)
chr7 (174-226)||(3975788-3975840)
chr7 (174-226)||(8144608-8144660)
chr7 (174-226)||(20355406-20355458)
chr7 (174-226)||(23399610-23399662)
chr7 (174-226)||(23676130-23676182)
chr7 (174-226)||(29198612-29198664)
chr7 (174-226)||(39832904-39832956)
chr7 (176-228)||(48359023-48359075)
[»] chr6 (35 HSPs)
chr6 (171-226)||(10910914-10910969)
chr6 (175-226)||(14656210-14656261)
chr6 (171-226)||(21993782-21993837)
chr6 (168-226)||(1214946-1215004)
chr6 (172-229)||(20467665-20467722)
chr6 (170-226)||(3968959-3969015)
chr6 (174-226)||(6412216-6412268)
chr6 (174-226)||(8170101-8170153)
chr6 (175-227)||(17765008-17765060)
chr6 (170-226)||(21385245-21385301)
chr6 (174-226)||(22543668-22543720)
chr6 (175-226)||(3276304-3276355)
chr6 (175-226)||(3968644-3968695)
chr6 (167-226)||(12419888-12419947)
chr6 (175-226)||(12757609-12757660)
chr6 (175-226)||(13150700-13150751)
chr6 (175-226)||(19690392-19690443)
chr6 (172-226)||(318047-318101)
chr6 (172-226)||(1007459-1007513)
chr6 (176-226)||(10910629-10910679)
chr6 (175-229)||(12299087-12299141)
chr6 (176-226)||(24901239-24901289)
chr6 (173-226)||(12419705-12419758)
chr6 (174-227)||(19321080-19321133)
chr6 (173-226)||(22543351-22543404)
chr6 (173-226)||(25121181-25121233)
chr6 (173-226)||(25137307-25137360)
chr6 (175-224)||(26375692-26375741)
chr6 (165-226)||(31198604-31198665)
chr6 (173-226)||(32885670-32885723)
chr6 (174-226)||(3414385-3414437)
chr6 (174-226)||(15962025-15962077)
chr6 (174-226)||(18024325-18024377)
chr6 (174-226)||(21994353-21994405)
chr6 (174-226)||(25431804-25431856)
[»] chr1 (40 HSPs)
chr1 (171-226)||(39747785-39747840)
chr1 (175-228)||(15058714-15058767)
chr1 (177-226)||(32420099-32420148)
chr1 (172-229)||(41358610-41358667)
chr1 (175-224)||(49073690-49073739)
chr1 (174-226)||(8140432-8140484)
chr1 (174-226)||(10887548-10887600)
chr1 (178-226)||(26207280-26207328)
chr1 (174-226)||(31404672-31404724)
chr1 (174-226)||(45380270-45380322)
chr1 (175-226)||(3247197-3247248)
chr1 (175-226)||(12360918-12360969)
chr1 (175-226)||(15526312-15526363)
chr1 (175-226)||(19720711-19720762)
chr1 (175-226)||(30322928-30322979)
chr1 (175-226)||(31061101-31061152)
chr1 (175-226)||(33000619-33000670)
chr1 (174-229)||(45638841-45638896)
chr1 (176-226)||(10631164-10631214)
chr1 (176-226)||(20948755-20948805)
chr1 (176-226)||(24507479-24507529)
chr1 (175-225)||(24654118-24654168)
chr1 (176-226)||(24977778-24977828)
chr1 (175-229)||(32626528-32626582)
chr1 (176-226)||(35056530-35056580)
chr1 (176-226)||(40718110-40718160)
chr1 (172-226)||(42482975-42483029)
chr1 (176-226)||(46868527-46868577)
chr1 (172-226)||(47819228-47819282)
chr1 (173-226)||(22674200-22674253)
chr1 (174-223)||(33067346-33067395)
chr1 (178-226)||(4789310-4789358)
chr1 (174-226)||(7867127-7867179)
chr1 (174-226)||(10887231-10887283)
chr1 (176-224)||(12322922-12322970)
chr1 (174-226)||(13260271-13260323)
chr1 (174-226)||(19622653-19622705)
chr1 (174-226)||(21391094-21391146)
chr1 (170-226)||(38164245-38164301)
chr1 (174-226)||(48609544-48609596)
[»] chr5 (27 HSPs)
chr5 (172-226)||(20690729-20690783)
chr5 (173-226)||(5917123-5917176)
chr5 (173-226)||(19685014-19685067)
chr5 (174-226)||(10744004-10744056)
chr5 (174-226)||(14318043-14318095)
chr5 (175-226)||(1381246-1381297)
chr5 (175-226)||(18258477-18258528)
chr5 (175-226)||(19565466-19565517)
chr5 (175-226)||(21124912-21124963)
chr5 (178-229)||(35609584-35609635)
chr5 (174-225)||(35877003-35877054)
chr5 (176-226)||(45138-45188)
chr5 (176-226)||(30888160-30888210)
chr5 (176-226)||(35928408-35928458)
chr5 (173-226)||(24443694-24443747)
chr5 (176-229)||(29366896-29366949)
chr5 (173-226)||(36577719-36577772)
chr5 (174-226)||(1105098-1105150)
chr5 (174-226)||(5904006-5904058)
chr5 (178-226)||(6912807-6912855)
chr5 (173-225)||(17070814-17070866)
chr5 (174-226)||(19565781-19565833)
chr5 (173-229)||(23381947-23382003)
chr5 (176-228)||(36973353-36973405)
chr5 (172-224)||(40038490-40038542)
chr5 (170-226)||(40167958-40168014)
chr5 (174-226)||(42207240-42207292)
[»] scaffold0179 (1 HSPs)
scaffold0179 (174-226)||(3241-3293)
[»] scaffold0160 (1 HSPs)
scaffold0160 (174-226)||(27314-27366)
[»] scaffold0024 (2 HSPs)
scaffold0024 (174-226)||(75357-75409)
scaffold0024 (174-226)||(75714-75766)
[»] scaffold0326 (4 HSPs)
scaffold0326 (175-226)||(4238-4289)
scaffold0326 (175-226)||(19420-19471)
scaffold0326 (174-226)||(4039-4091)
scaffold0326 (174-226)||(19221-19273)
[»] scaffold0005 (1 HSPs)
scaffold0005 (175-226)||(47924-47975)
[»] scaffold0026 (1 HSPs)
scaffold0026 (172-226)||(82656-82710)
[»] scaffold0003 (1 HSPs)
scaffold0003 (176-226)||(365979-366029)
[»] scaffold0001 (1 HSPs)
scaffold0001 (176-226)||(148232-148282)
[»] scaffold0016 (1 HSPs)
scaffold0016 (173-229)||(10462-10518)


Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 39)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 32494609 - 32494441
Alignment:
7 ttatttaccgaaagaaatatagtccttcaaagttcaatttatctggagcactatagtagcgtgattggtaattctggtagatcagattttaaggatctta 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||    
32494609 ttatttaccgaaagaaatatagtccttcaaagttcaatttatctggaacactatagtagcttgattggtaattctggtagatcagattttaaggatatta 32494510  T
107 ttaggaactcaattggtggttgaatgactggttttgtggacagatataatcatactactaatattaata 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32494509 ttaggaactcaattggtggttgaatgactggttttgtggacagatataatcatactactaatattaata 32494441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 33575750 - 33575802
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||| || | |||| |||||||||||||||||||||    
33575750 taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 33575802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 226
Target Start/End: Original strand, 41451831 - 41451887
Alignment:
170 ttaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||||  || | |||| |||||||||||||||||||||    
41451831 ttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 41451887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 4794130 - 4794180
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| || | |||| |||||||||||||||||||||    
4794130 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 4794180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 168 - 226
Target Start/End: Complemental strand, 16523333 - 16523275
Alignment:
168 tattaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
16523333 tattaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 16523275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 229
Target Start/End: Complemental strand, 36815836 - 36815782
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    |||||||||||||||||||  || | |||| ||||||||||||||||||||||||    
36815836 aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcc 36815782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 226
Target Start/End: Original strand, 13215053 - 13215110
Alignment:
169 attaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
13215053 attactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 13215110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 44559059 - 44559112
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| |||||||||||||||||||||    
44559059 ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 44559112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 1138361 - 1138309
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||| || | |||| |||||||||||| ||||||||    
1138361 taggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagt 1138309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 20131315 - 20131367
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
20131315 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 20131367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 44985986 - 44985934
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| | || | |||| |||||||||||||||||||||    
44985986 taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 44985934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 2481192 - 2481243
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   ||| |||| |||||||||||||||||||||    
2481192 aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagt 2481243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 4042609 - 4042660
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| ||| |||||||||||||||||    
4042609 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 4042660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 4424186 - 4424135
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
4424186 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 4424135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 17541777 - 17541726
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||| | || | |||| |||||||||||||||||||||    
17541777 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 17541726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 24358946 - 24358895
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| ||| |||||||||||||||||    
24358946 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 24358895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 25705084 - 25705135
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
25705084 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25705135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 31644840 - 31644891
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
31644840 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 31644891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 33576118 - 33576067
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
33576118 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 33576067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 10671945 - 10671891
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||   || | |||| |||||||||||||||||||||    
10671945 aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 10671891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 11788420 - 11788366
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||   || | |||| |||||||||||||||||||||    
11788420 aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 11788366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 226
Target Start/End: Original strand, 16522979 - 16523041
Alignment:
165 taatattaata-ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||| ||||||||||||||||||  || | |||| ||| |||||||||||||||||    
16522979 taatattaataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 16523041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 23732039 - 23732089
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||| |||||| || | |||| |||||||||||||||||||||    
23732039 ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt 23732089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 27109073 - 27109123
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || |||||| ||| |||||||||||||||||    
27109073 ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt 27109123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 42695868 - 42695918
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
42695868 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 42695918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 4794468 - 4794423
Alignment:
181 aaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||  || |||||| |||||||||||||||||||||    
4794468 aaatatggttttggtccctacaaatatgtctcgttttggttttagt 4794423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 229
Target Start/End: Original strand, 9195054 - 9195107
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    |||||||||||||||||   || | |||| ||||||||||||||||||||||||    
9195054 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcc 9195107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 20939324 - 20939275
Alignment:
177 gctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||  || | |||| |||||||||||||||||||||    
20939324 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 20939275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 29182440 - 29182391
Alignment:
178 ctaaaatatggttttgacccttacaaacatgtctcgttttggttttagtt 227  Q
    |||||||||| |||||| || | |||| ||||||||||||||||||||||    
29182440 ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtt 29182391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 36815485 - 36815538
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||| ||  |  ||| |||||||||||||||||||||    
36815485 ataggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagt 36815538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 42696202 - 42696153
Alignment:
177 gctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||| || | |||| ||| |||||||||||||||||    
42696202 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 42696153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 10671628 - 10671680
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| || ||||||||||||||||||    
10671628 taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagt 10671680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 24358614 - 24358666
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
24358614 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 24358666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 25705451 - 25705399
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
25705451 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 25705399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 37910754 - 37910806
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||| |||| |||| ||| ||| |||| ||||||||    
37910754 taggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagt 37910806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 38639410 - 38639462
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
38639410 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 38639462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 43592044 - 43592096
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   |||| |||| ||| |||||||||||||||||    
43592044 taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 43592096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 44559407 - 44559359
Alignment:
178 ctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||  || | |||| |||||||||||||||||||||    
44559407 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 44559359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 226
Target Start/End: Complemental strand, 44994067 - 44994011
Alignment:
170 ttaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| |||||||||||||||||| | || | |||| |||||||||||| ||||||||    
44994067 ttaaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagt 44994011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 35086 - 35034
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||| || |||||| |||||||||||||||||||||    
35086 taggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagt 35034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 46)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 229
Target Start/End: Original strand, 25600224 - 25600283
Alignment:
170 ttaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||||||  || | |||| ||||||||||||||||||||||||    
25600224 ttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcc 25600283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 9496339 - 9496394
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||  || | |||| ||||||||||||||||||||||||    
9496339 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcc 9496394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 20984511 - 20984460
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || |||||| |||||||||||||||||||||    
20984511 aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagt 20984460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 172 - 226
Target Start/End: Original strand, 35097324 - 35097378
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| |||||||||||||||||||||    
35097324 aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35097378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 35347002 - 35346948
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| |||||||||||||||||||||    
35347002 aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35346948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 44998263 - 44998213
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| |  |||||| |||||||||||||||||||||    
44998263 ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagt 44998213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 226
Target Start/End: Original strand, 1778557 - 1778614
Alignment:
169 attaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||| ||||||||||||||||||  || | |||| |||||||||||||||||||||    
1778557 attaattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 1778614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 7326083 - 7326136
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  |||| |||| ||| |||||||||||||||||    
7326083 ataggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagt 7326136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 13154883 - 13154936
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||| ||||||| |||| |||| ||| |||||||||||||||||    
13154883 ataggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagt 13154936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 229
Target Start/End: Original strand, 19494115 - 19494172
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    |||||||||||||||||||||   || | |||| ||||||||||||||||||||||||    
19494115 aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcc 19494172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 28258244 - 28258191
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| |||  | |||| |||||||||||||||||||||    
28258244 ataggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagt 28258191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 30969399 - 30969448
Alignment:
177 gctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||  ||||||||| |||| ||||||||||||||||    
30969399 gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagt 30969448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 3512268 - 3512216
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
3512268 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3512216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 10337117 - 10337169
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
10337117 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 10337169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 226
Target Start/End: Complemental strand, 2811778 - 2811731
Alignment:
179 taaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||| || | |||| |||||||||||||||||||||    
2811778 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 2811731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 4474045 - 4473994
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| ||| |||||||||||||||||    
4474045 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 4473994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 7420229 - 7420280
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
7420229 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 7420280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 8298976 - 8298925
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
8298976 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8298925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 9175011 - 9175062
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||| |||||  |||| |||| |||||||||||||||||||||    
9175011 aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagt 9175062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 10872914 - 10872965
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| ||| |||||||||||||||||    
10872914 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 10872965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 11019519 - 11019570
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
11019519 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 11019570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 24815069 - 24815018
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| ||| | |||| ||||||| |||||||||||||    
24815069 aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagt 24815018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 28324182 - 28324131
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || |||||| |||||| ||||||||||||||    
28324182 aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagt 28324131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 32725906 - 32725957
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
32725906 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 32725957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 7186004 - 7185954
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
7186004 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 7185954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 8298587 - 8298637
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
8298587 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8298637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
178 ctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    ||||||||||||||||| || | |||| |||||||||||||||||||    
13779151 ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta 13779197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 14489073 - 14489023
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
14489073 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 14489023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 229
Target Start/End: Original strand, 16789074 - 16789128
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||   || | |||| ||||||||||||||||||||||||    
16789074 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcc 16789128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 229
Target Start/End: Original strand, 25131110 - 25131164
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||   || | |||| ||||||||||||||||||||||||    
25131110 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcc 25131164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 34963664 - 34963614
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
34963664 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 34963614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 35346629 - 35346679
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
35346629 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35346679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 42133154 - 42133104
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
42133154 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 42133104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 17073804 - 17073857
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| ||||||| |||||||||||||    
17073804 ataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 17073857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 17574466 - 17574413
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| ||||||| |||||||||||||    
17574466 ataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 17574413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 29158351 - 29158404
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||   || | |||| |||||||||||||||||||||    
29158351 ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 29158404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 3511904 - 3511956
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
3511904 taggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagt 3511956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 4473702 - 4473754
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| | |||||||||||||||||||    
4473702 taggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagt 4473754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 4710222 - 4710170
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
4710222 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 4710170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 8094843 - 8094791
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   |||| |||| ||| |||||||||||||||||    
8094843 taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 8094791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 11019859 - 11019807
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
11019859 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 11019807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 11976738 - 11976686
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| |||||||||||||||  || | |||| |||||||||||||||||||||    
11976738 taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 11976686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 27117751 - 27117803
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||||||||||||| |||||||    
27117751 taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagt 27117803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 28346760 - 28346708
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
28346760 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 28346708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 32726273 - 32726221
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
32726273 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 32726221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 224
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||    
42132864 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 42132912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 33)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 30128282 - 30128337
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||  || | |||||||||||||||||||||||||||||    
30128282 taggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcc 30128337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 30034476 - 30034422
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  |||| |||| |||||||||||||||||||||    
30034476 aataggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagt 30034422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 474411 - 474355
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    |||||||||||||||||||||  || | |||| ||||||||||||||||||||||||    
474411 ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcc 474355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 15979703 - 15979651
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || |||||| |||||||||||||||||||||    
15979703 taggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagt 15979651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 229
Target Start/End: Original strand, 45002015 - 45002074
Alignment:
170 ttaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||||||  || | |||| ||| ||||||||||||||||||||    
45002015 ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcc 45002074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 9603626 - 9603679
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||| || | |||| ||| |||||||||||||||||    
9603626 ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 9603679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 229
Target Start/End: Original strand, 30130150 - 30130211
Alignment:
168 tattaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    |||| ||||||||||||||||||||   || | |||| ||||||||||||||||||||||||    
30130150 tatttataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcc 30130211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 229
Target Start/End: Original strand, 43441270 - 43441323
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||  || | |||| ||||||||||||||||||||||||    
43441270 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcc 43441323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 47336584 - 47336531
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| |||||||||||||||||||||    
47336584 ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 47336531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 54608866 - 54608813
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| |||||||||||||||||||||    
54608866 ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 54608813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 12740905 - 12740957
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
12740905 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 12740957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 28452145 - 28452197
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  |||| |||| |||||| ||||||||||||||    
28452145 taggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagt 28452197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 29490745 - 29490693
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
29490745 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 29490693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 46622131 - 46622079
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  |||| |||| |||| ||||||||||||||||    
46622131 taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagt 46622079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 51550448 - 51550396
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
51550448 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 51550396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 474043 - 474094
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
474043 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 474094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 226
Target Start/End: Original strand, 3387268 - 3387315
Alignment:
179 taaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||| || | |||| |||||||||||||||||||||    
3387268 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 3387315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 12741272 - 12741221
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
12741272 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 12741221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 43441604 - 43441553
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| ||| |||||||||||||||||    
43441604 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 43441553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 4034717 - 4034767
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
4034717 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 4034767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 229
Target Start/End: Complemental strand, 4035062 - 4035000
Alignment:
167 atattaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    |||||||| ||||||||||||||||||  || | |||| ||| |||||||| |||||||||||    
4035062 atattaattggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcc 4035000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 224
Target Start/End: Original strand, 4321944 - 4321994
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    ||||||||||||||||| ||| |||| |||| ||||||| |||||||||||    
4321944 taggctaaaatatggttctgatccttgcaaatatgtctcattttggtttta 4321994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 26090078 - 26090028
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
26090078 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 26090028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 35407794 - 35407740
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||| || | |||| |||||| ||||| ||||||||    
35407794 aataggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagt 35407740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 9262158 - 9262105
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
9262158 ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 9262105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 1721087 - 1721139
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| |||||||||||||||  |||| |||| ||||||| |||||||||||||    
1721087 taggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagt 1721139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 25609765 - 25609817
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  | ||||||| | | |||||||||||||||||    
25609765 taggctaaaatatggttttggtctttacaaataagcctcgttttggttttagt 25609817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 28452378 - 28452326
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || |||||| |||  ||||||||||||||||    
28452378 taggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagt 28452326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 28552385 - 28552333
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
28552385 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 28552333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 34238596 - 34238648
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
34238596 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 34238648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 35177254 - 35177306
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagtt 227  Q
    ||||||||||||| |||||  || | |||| ||||||||||||||||||||||    
35177254 aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtt 35177306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 39288900 - 39288848
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| | || | |||| ||| |||||||||||||||||    
39288900 taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 39288848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 51550080 - 51550132
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
51550080 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 51550132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 38)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 26412187 - 26412240
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||| || | |||| |||||||||||||||||||||    
26412187 ataggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 26412240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 172 - 229
Target Start/End: Complemental strand, 53916051 - 53915994
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||||  || | |||| ||||||||||||||||||||||||    
53916051 aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcc 53915994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 23245597 - 23245545
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||| || | |||| |||||||||||||||||||||    
23245597 taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 23245545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 2322433 - 2322382
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| |||||||||||||||||||||    
2322433 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 2322382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 226
Target Start/End: Original strand, 22584282 - 22584337
Alignment:
171 taataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||   |||| |||| |||||||||||||||||||||    
22584282 taataggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 22584337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 44925484 - 44925535
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| |||||||||||||||||||||    
44925484 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 44925535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 51738134 - 51738185
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    |||||||||||||||||||||  || |||||| |||||||||||||||||||    
51738134 ataggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta 51738185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 229
Target Start/End: Complemental strand, 47532675 - 47532619
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||| ||||||||||  |||| |||| ||||||||||||||||||||||||    
47532675 aataggctaaa-tatggttttggtccttgcaaatatgtctcgttttggttttagttcc 47532619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 224
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    |||||||||||||||||||  |||| |||| |||||||||||||||||||    
52543421 aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 52543470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 13631226 - 13631278
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
13631226 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 13631278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 28448832 - 28448884
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   ||||||||| ||| |||||||||||||||||    
28448832 taggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagt 28448884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 29420539 - 29420487
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
29420539 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 29420487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 35464016 - 35464068
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
35464016 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35464068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 47023107 - 47023055
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||| || | |||| |||| ||||||||||||||||    
47023107 taggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagt 47023055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 5797823 - 5797772
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    ||||| |||||||||||||||  || |||||| |||||||||||||||||||    
5797823 ataggttaaaatatggttttggtccctacaaatatgtctcgttttggtttta 5797772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 14791807 - 14791756
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
14791807 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 14791756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 25423923 - 25423974
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
25423923 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25423974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 25424313 - 25424262
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
25424313 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25424262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 26314333 - 26314282
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || |  ||| |||||||||||||||||||||    
26314333 aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagt 26314282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 31811924 - 31811975
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| |||| ||||||||||||||||    
31811924 aggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagt 31811975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 43231087 - 43231138
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
43231087 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 43231138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 226
Target Start/End: Original strand, 47022743 - 47022790
Alignment:
179 taaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||  |||| |||| |||||||||||||||||||||    
47022743 taaaatatggttttggtccttgcaaatatgtctcgttttggttttagt 47022790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 52442093 - 52442042
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||   |||| |||| |||||||||||||||||||||    
52442093 aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 52442042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 11693125 - 11693071
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| ||||||||||||| |||||||    
11693125 aataggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagt 11693071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 13073759 - 13073809
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
13073759 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 13073809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Original strand, 13530375 - 13530429
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| ||||||||||||| |||||||    
13530375 aataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagt 13530429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 2322094 - 2322143
Alignment:
177 gctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||  || |||||| ||| |||||||||||||||||    
2322094 gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt 2322143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 9289263 - 9289316
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||   || | |||| |||||||||||||||||||||    
9289263 ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 9289316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 174 - 223
Target Start/End: Complemental strand, 12152495 - 12152446
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggtttt 223  Q
    ||||||||||||||||||||  || | |||| ||||||||||||||||||    
12152495 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt 12152446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 224
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    |||||||||||||||||||  |||| |||| ||||||||||||| |||||    
28449215 aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta 28449166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 4279020 - 4279072
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  ||| | |||| || ||||||||||||||||||    
4279020 taggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagt 4279072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 13479613 - 13479561
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
13479613 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 13479561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 14488189 - 14488137
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||||||| |||||||||||||    
14488189 taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 14488137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 19903653 - 19903605
Alignment:
178 ctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||  || | |||| |||||||||||||||||||||    
19903653 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19903605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 226
Target Start/End: Complemental strand, 29380916 - 29380860
Alignment:
170 ttaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| ||||||||||||||||||   || | |||| |||||||||||||||||||||    
29380916 ttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 29380860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 35420701 - 35420653
Alignment:
178 ctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||  |||| |||| |||||||| ||||||||||||    
35420701 ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagt 35420653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 42823774 - 42823826
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||| |||||  || | |||| |||||||||||||||||||||    
42823774 taggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 42823826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 46088062 - 46088010
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
46088062 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 46088010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 36)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 5234205 - 5234154
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || |||||| |||||||||||||||||||||    
5234205 aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagt 5234154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 44568691 - 44568640
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| |||||||||||||||||||||    
44568691 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 44568640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 1614556 - 1614609
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| |||||||||||||||||||||    
1614556 ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 1614609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 224
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    |||||||||||||||||||| || | |||| |||||||||||||||||||    
34878126 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta 34878077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 25988383 - 25988435
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
25988383 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25988435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 35665875 - 35665927
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| | || |||||| ||| |||||||||||||||||    
35665875 taggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagt 35665927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 35838339 - 35838287
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
35838339 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35838287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 46759656 - 46759708
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
46759656 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 46759708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 8144294 - 8144345
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
8144294 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8144345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 22539928 - 22539983
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||| || | |||| ||| ||| ||||||||||||||||    
22539928 taggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcc 22539983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 23399977 - 23399926
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
23399977 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 23399926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 25092159 - 25092210
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
25092159 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25092210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 26877677 - 26877728
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| |  | |||| |||||||||||||||||||||    
26877677 aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagt 26877728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 27458398 - 27458449
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
27458398 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 27458449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 35837923 - 35837974
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
35837923 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35837974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 39520397 - 39520448
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
39520397 aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagt 39520448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 44958507 - 44958456
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||| |||||  || |||||| |||||||||||||||||||||    
44958507 aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagt 44958456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 226
Target Start/End: Complemental strand, 48192493 - 48192438
Alignment:
171 taataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
48192493 taataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 48192438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Original strand, 9659351 - 9659405
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| ||||||||||||| |||||||    
9659351 aataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagt 9659405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 24717532 - 24717482
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || ||| || |||||||||||||||||||||    
24717532 ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagt 24717482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 226
Target Start/End: Complemental strand, 26878079 - 26878021
Alignment:
168 tattaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| |||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
26878079 tatttataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 26878021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 35469880 - 35469930
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| || | |||| |||| ||||||||||||||||    
35469880 ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagt 35469930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 41364884 - 41364934
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||| | |  |||||| |||||||||||||||||||||    
41364884 ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagt 41364934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 44403249 - 44403199
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||   |||| |||| |||||||||||||||||||||    
44403249 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 44403199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 46829312 - 46829262
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| || | |||| ||||||| |||||||||||||    
46829312 ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagt 46829262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 23676455 - 23676402
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
23676455 ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 23676402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 228
Target Start/End: Original strand, 25547248 - 25547305
Alignment:
171 taataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttc 228  Q
    ||||||| |||||||||||||| | || | |||| ||| |||||||||||||||||||    
25547248 taataggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagttc 25547305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 29198300 - 29198353
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| || ||||||||||||||||||    
29198300 ataggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagt 29198353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 3975840 - 3975788
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
3975840 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 3975788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 8144660 - 8144608
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
8144660 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 8144608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 20355406 - 20355458
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||| |||||| |||| |||| ||| |||||||||||| ||||    
20355406 taggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagt 20355458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 23399610 - 23399662
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
23399610 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 23399662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 23676130 - 23676182
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| |||||||||||||||  || | |||| |||||||||||||||||||||    
23676130 taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 23676182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 29198664 - 29198612
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
29198664 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 29198612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 39832904 - 39832956
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
39832904 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 39832956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 228
Target Start/End: Complemental strand, 48359075 - 48359023
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttc 228  Q
    |||||||||||||||||   || | |||| |||||||||||||||||||||||    
48359075 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttc 48359023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 35)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 226
Target Start/End: Complemental strand, 10910969 - 10910914
Alignment:
171 taataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||||  || | |||| |||||||||||||||||||||    
10910969 taataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 10910914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 14656261 - 14656210
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  |||| |||| |||||||||||||||||||||    
14656261 aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagt 14656210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 226
Target Start/End: Original strand, 21993782 - 21993837
Alignment:
171 taataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||||  || | |||| |||||||||||||||||||||    
21993782 taataggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagt 21993837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 168 - 226
Target Start/End: Complemental strand, 1215004 - 1214946
Alignment:
168 tattaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||| ||||||||||||||||||||| |  | |||| |||||||||||||||||||||    
1215004 tattattaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagt 1214946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 229
Target Start/End: Complemental strand, 20467722 - 20467665
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||||  || | |||| ||| ||||||||||||||||||||    
20467722 aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcc 20467665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 226
Target Start/End: Complemental strand, 3969015 - 3968959
Alignment:
170 ttaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
3969015 ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 3968959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 6412216 - 6412268
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
6412216 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 6412268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 8170153 - 8170101
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
8170153 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8170101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 17765008 - 17765060
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagtt 227  Q
    |||||||||||||||||||  || | |||| ||||||||||||||||||||||    
17765008 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt 17765060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 226
Target Start/End: Original strand, 21385245 - 21385301
Alignment:
170 ttaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| |||||||||||||||||||  || | |||| |||||||||||||||||||||    
21385245 ttaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 21385301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 22543720 - 22543668
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
22543720 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 22543668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 3276355 - 3276304
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
3276355 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3276304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 3968644 - 3968695
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
3968644 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3968695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 226
Target Start/End: Complemental strand, 12419947 - 12419888
Alignment:
167 atattaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| ||||||||||||||||||||| | || | |||| ||| |||||||||||||||||    
12419947 atataaataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 12419888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 12757609 - 12757660
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
12757609 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 12757660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 13150751 - 13150700
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||| || |||| | |||| |||||||||||||||||||||    
13150751 aggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagt 13150700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 19690392 - 19690443
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
19690392 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19690443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 318101 - 318047
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||| | || | |||| |||| ||||||||||||||||    
318101 aataggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagt 318047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 1007513 - 1007459
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
1007513 aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 1007459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 10910629 - 10910679
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  |  |||||| |||||||||||||||||||||    
10910629 ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagt 10910679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 229
Target Start/End: Complemental strand, 12299141 - 12299087
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    |||||||||||||||||||  || | |||| ||| ||||||||||||||||||||    
12299141 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcc 12299087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 24901239 - 24901289
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
24901239 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 24901289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 12419705 - 12419758
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| | || | |||| ||| |||||||||||||||||    
12419705 ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 12419758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 174 - 227
Target Start/End: Complemental strand, 19321133 - 19321080
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagtt 227  Q
    ||||||||||||||||||||  || | |||| ||| ||||||||||||||||||    
19321133 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtt 19321080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 22543351 - 22543404
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
22543351 ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 22543404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 25121181 - 25121233
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| | |||  |||| |||||||||||||||||||||    
25121181 ataggctaaaatatggttttcatcctg-caaatatgtctcgttttggttttagt 25121233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 25137360 - 25137307
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
25137360 ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 25137307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 224
Target Start/End: Original strand, 26375692 - 26375741
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    |||||||||||||||||| | || | |||| |||||||||||||||||||    
26375692 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta 26375741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 165 - 226
Target Start/End: Original strand, 31198604 - 31198665
Alignment:
165 taatattaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| ||||| ||||||||||||||||||  || | |||| ||| |||||||||||||||||    
31198604 taatgttaatgggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagt 31198665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 32885670 - 32885723
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| | || | |||| ||| |||||||||||||||||    
32885670 ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 32885723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 3414385 - 3414437
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
3414385 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 3414437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 15962025 - 15962077
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   |||| |||| ||| |||||||||||||||||    
15962025 taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 15962077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 18024377 - 18024325
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||| ||||||||||||||    
18024377 taggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagt 18024325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 21994405 - 21994353
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
21994405 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 21994353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 25431856 - 25431804
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
25431856 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 25431804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 40)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 226
Target Start/End: Complemental strand, 39747840 - 39747785
Alignment:
171 taataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||||  || | |||| |||||||||||||||||||||    
39747840 taataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 39747785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 228
Target Start/End: Complemental strand, 15058767 - 15058714
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttc 228  Q
    |||||||||||| ||||||| || | |||| |||||||||||||||||||||||    
15058767 aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttc 15058714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 32420099 - 32420148
Alignment:
177 gctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||  |||| |||| |||||||||||||||||||||    
32420099 gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagt 32420148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 229
Target Start/End: Complemental strand, 41358667 - 41358610
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    |||||||||||||||||||||   || | |||| ||||||||||||||||||||||||    
41358667 aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcc 41358610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 224
Target Start/End: Original strand, 49073690 - 49073739
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    |||||||||||||||||||  |||| |||| |||||||||||||||||||    
49073690 aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 49073739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 8140432 - 8140484
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
8140432 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8140484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 10887600 - 10887548
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
10887600 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 10887548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 26207280 - 26207328
Alignment:
178 ctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||  |||| |||| |||||||||||||||||||||    
26207280 ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagt 26207328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 31404724 - 31404672
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || ||||||||||||||||| | ||||||||    
31404724 taggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagt 31404672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 45380270 - 45380322
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
45380270 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 45380322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 3247197 - 3247248
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
3247197 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3247248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 12360969 - 12360918
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
12360969 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 12360918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 15526363 - 15526312
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
15526363 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 15526312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 19720711 - 19720762
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
19720711 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19720762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 30322928 - 30322979
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
30322928 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 30322979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 31061152 - 31061101
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||| || | |||| || ||||||||||||||||||    
31061152 aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagt 31061101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 33000670 - 33000619
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
33000670 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 33000619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 229
Target Start/End: Complemental strand, 45638896 - 45638841
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||  || | |||| ||||||||||||||||||| ||||    
45638896 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcc 45638841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 10631164 - 10631214
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
10631164 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 10631214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 20948755 - 20948805
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || |||||| ||||||||||| |||||||||    
20948755 ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagt 20948805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 24507479 - 24507529
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| || | |||| ||| |||||||||||||||||    
24507479 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 24507529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 225
Target Start/End: Complemental strand, 24654168 - 24654118
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttag 225  Q
    |||||||||||||||||||  || | |||| ||||||||||||||||||||    
24654168 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag 24654118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 24977778 - 24977828
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
24977778 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 24977828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 229
Target Start/End: Original strand, 32626528 - 32626582
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||   || | |||| ||||||||||||||||||||||||    
32626528 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcc 32626582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 35056530 - 35056580
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
35056530 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35056580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 40718110 - 40718160
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
40718110 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 40718160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Original strand, 42482975 - 42483029
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| ||||||| |||||||||||||    
42482975 aataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 42483029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 46868577 - 46868527
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||| | || | |||| |||||||||||||||||||||    
46868577 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 46868527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Original strand, 47819228 - 47819282
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
47819228 aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 47819282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 22674200 - 22674253
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| |  || | |||| |||||||||||||||||||||    
22674200 ataggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagt 22674253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 33067346 - 33067395
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggtttt 223  Q
    |||||||||||||||||||   |||| |||| ||||||||||||||||||    
33067346 taggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt 33067395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 4789310 - 4789358
Alignment:
178 ctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||  || | |||| |||||||||||||||||||||    
4789310 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 4789358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 7867127 - 7867179
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   |||| |||| |||||||||||| ||||||||    
7867127 taggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagt 7867179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 10887231 - 10887283
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||| ||||||||||||||||    
10887231 taggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagt 10887283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 224
Target Start/End: Complemental strand, 12322970 - 12322922
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||    
12322970 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 12322922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 13260323 - 13260271
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
13260323 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 13260271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 19622653 - 19622705
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
19622653 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 19622705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 21391094 - 21391146
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
21391094 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 21391146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 226
Target Start/End: Complemental strand, 38164301 - 38164245
Alignment:
170 ttaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||| |||||||||||||||||||  || | |||| ||| |||||||||||||||||    
38164301 ttaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 38164245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 48609596 - 48609544
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
48609596 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 48609544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 27)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 172 - 226
Target Start/End: Original strand, 20690729 - 20690783
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| |||||||||||||||||||||    
20690729 aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 20690783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 5917123 - 5917176
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| |||||||||||||||||||||    
5917123 ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 5917176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 19685014 - 19685067
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| |||||||||||||||||||||    
19685014 ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19685067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 10744056 - 10744004
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   |||| |||| |||||||||||||||||||||    
10744056 taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 10744004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 14318043 - 14318095
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   |||| |||| |||||||||||||||||||||    
14318043 taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 14318095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 1381246 - 1381297
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
1381246 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 1381297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 18258528 - 18258477
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
18258528 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 18258477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 19565466 - 19565517
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
19565466 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19565517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 21124912 - 21124963
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||| | || | |||| |||||||||||||||||||||    
21124912 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 21124963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 229
Target Start/End: Complemental strand, 35609635 - 35609584
Alignment:
178 ctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||  || | |||| ||||||||||||||||||||||||    
35609635 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcc 35609584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 35877054 - 35877003
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttag 225  Q
    ||||||||||||||||||||  || | |||| ||||||||||||||||||||    
35877054 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag 35877003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 45138 - 45188
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
45138 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 45188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 30888160 - 30888210
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
30888160 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 30888210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 35928458 - 35928408
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
35928458 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35928408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 24443747 - 24443694
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
24443747 ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 24443694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 229
Target Start/End: Complemental strand, 29366949 - 29366896
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    |||||||||||||||||   || | |||| ||||||||||||||||||||||||    
29366949 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcc 29366896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 36577719 - 36577772
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||   || | |||| |||||||||||||||||||||    
36577719 ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 36577772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 1105150 - 1105098
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
1105150 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 1105098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 5904006 - 5904058
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  |||| |||| ||| ||||||||| |||||||    
5904006 taggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagt 5904058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 6912855 - 6912807
Alignment:
178 ctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||  || | |||| |||||||||||||||||||||    
6912855 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 6912807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 17070866 - 17070814
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttag 225  Q
    ||||||||||||||||||||   || |||||| |||||||||||| |||||||    
17070866 ataggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag 17070814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 19565833 - 19565781
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
19565833 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 19565781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 23381947 - 23382003
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||   || | |||| |||||| |||||||||||||||||    
23381947 ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcc 23382003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 228
Target Start/End: Original strand, 36973353 - 36973405
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttc 228  Q
    ||||||||||||||||||  |  | |||| |||||||||||||||||||||||    
36973353 ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagttc 36973405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 224
Target Start/End: Original strand, 40038490 - 40038542
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggtttta 224  Q
    ||||||||||||||||||||||| || | |||| ||| ||||||||| |||||    
40038490 aataggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta 40038542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 226
Target Start/End: Complemental strand, 40168014 - 40167958
Alignment:
170 ttaataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||| |||||   || | |||| |||||||||||||||||||||    
40168014 ttaataggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagt 40167958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 42207240 - 42207292
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   ||||  ||| |||||||||||||||||||||    
42207240 taggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagt 42207292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 3293 - 3241
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||| | || | |||| |||||||||||||||||||||    
3293 taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 3241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 27366 - 27314
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
27366 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 27314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 75357 - 75409
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| |||||||||||||||||||||    
75357 taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagt 75409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 75766 - 75714
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
75766 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 75714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326 (Bit Score: 32; Significance: 0.000000005; HSPs: 4)
Name: scaffold0326
Description:

Target: scaffold0326; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 4289 - 4238
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||| | || | |||| |||||||||||||||||||||    
4289 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 4238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 19471 - 19420
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||| | || | |||| |||||||||||||||||||||    
19471 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 19420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 4039 - 4091
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
4039 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 4091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 19221 - 19273
Alignment:
174 taggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||   || | |||| |||||||||||||||||||||    
19221 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 19273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 47924 - 47975
Alignment:
175 aggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    |||||||||||||||||||  || | |||| |||||||||||||||||||||    
47924 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 47975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 82710 - 82656
Alignment:
172 aataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||||||  || | |||| ||| |||||||||||||||||    
82710 aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 82656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 365979 - 366029
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||| | |||| |||| ||| |||||||||||||||||    
365979 ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagt 366029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 148282 - 148232
Alignment:
176 ggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagt 226  Q
    ||||||||||||||||||  || | |||| |||||||||||||||||||||    
148282 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 148232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 10518 - 10462
Alignment:
173 ataggctaaaatatggttttgacccttacaaacatgtctcgttttggttttagttcc 229  Q
    ||||||||||||||||||||   || | |||| |||||| |||||||||||||||||    
10518 ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcc 10462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University