View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20722_low_22 (Length: 330)
Name: NF20722_low_22
Description: NF20722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20722_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 7e-74; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 3 - 151
Target Start/End: Complemental strand, 29930976 - 29930828
Alignment:
| Q |
3 |
ggtttattttttcttctctctctaatactatttctttcaagtatcgtaagacactaatatttatagccactactaccctaggtgtaagttagttacaacc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29930976 |
ggtttattttttcttctctctctaatactatttctttcaagtatcgtaagacactaatatttatagccactactactctaggtgtaagttagttacaacc |
29930877 |
T |
 |
| Q |
103 |
atcaaaacagaataaccaactgctgagttggcttgaacttcaagcaatc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29930876 |
atcaaaacagaataaccaactgctgagttggcttgagcttcaagcaatc |
29930828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 210 - 318
Target Start/End: Complemental strand, 29930768 - 29930660
Alignment:
| Q |
210 |
tttgatcaatatgagtttaggcaagtcatgagtggctattattcttatggtattatatccaagtacacttacttttgttcaaatagtgaaaaggtgcatg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29930768 |
tttgatcaatatgagtttaggcaagtcatgagtggctattattcttatggtattatatccaagtacacttacttttgttcaaatagtgaaaaggtgcatg |
29930669 |
T |
 |
| Q |
310 |
tgttatatt |
318 |
Q |
| |
|
||||||||| |
|
|
| T |
29930668 |
tgttatatt |
29930660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 217 - 265
Target Start/End: Complemental strand, 29428168 - 29428120
Alignment:
| Q |
217 |
aatatgagtttaggcaagtcatgagtggctattattcttatggtattat |
265 |
Q |
| |
|
||||||||||| | ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
29428168 |
aatatgagttttgccaactcatgagtggctattattcttatgatattat |
29428120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 217 - 264
Target Start/End: Original strand, 41746444 - 41746491
Alignment:
| Q |
217 |
aatatgagtttaggcaagtcatgagtggctattattcttatggtatta |
264 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||| ||||||||||| |
|
|
| T |
41746444 |
aatatgagtttagcccagtcatgagtggctattattattatggtatta |
41746491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University