View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20722_low_29 (Length: 280)
Name: NF20722_low_29
Description: NF20722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20722_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 61 - 262
Target Start/End: Complemental strand, 6627469 - 6627268
Alignment:
| Q |
61 |
gattcaaggaggagctcgcgcggcacgtggtttttcggcaacggtaaaaaatcaacgcgatcaaggaagctacgacacgtggatgatgctaacattgaat |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6627469 |
gattcaaggaggagctcgcgcggcacgtggtttttcggcaacggtaaaaaatcaacgcgatcaaggaagctacgacacgtggatgatgctaacgttgaat |
6627370 |
T |
|
| Q |
161 |
actcaaccgcaccgattcaacggtctccgagtgcacggggttatattcggtctaatacttcttcctccgttgcacctcagccgttgccgttgccggagtc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6627369 |
actcaaccgcaccgattcaacggtctccgagtgcacggggttatattcggtctaatacttcttcctccgttgcacctcagccgttgccgttgccggagtc |
6627270 |
T |
|
| Q |
261 |
ac |
262 |
Q |
| |
|
|| |
|
|
| T |
6627269 |
ac |
6627268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University