View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20723_low_2 (Length: 351)
Name: NF20723_low_2
Description: NF20723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20723_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 16 - 340
Target Start/End: Original strand, 43755553 - 43755877
Alignment:
| Q |
16 |
attgtatccttcttttcatcatatttatatgatcattcattttcaatgtttactatgctttgttgagaagatgagacttgaaaatgagctctaattttca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43755553 |
attgtatccttcttttcatcatatttatatgatcattcattttcaatgtttactatgctttgttgagaagatgaaacttgaaaatgagctctaattttca |
43755652 |
T |
 |
| Q |
116 |
atttgtttattttctactttattgaattatgttatagcaatgacatttctgtccaaaggcgtgtctgacatgtgtgtgtgcgtgcgcgacacatgtccaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
43755653 |
atttgtttattttctactttattgaattatgttatagcaacgacatttctgtccaaaggcgtgtctaacatgtgtgtgcgcgcgcgcgacacatgtccaa |
43755752 |
T |
 |
| Q |
216 |
caccggaaacatttgatcatatttaagtattcttttcttcaaattagtcgtgtttacgagtcattgttagcgtcgtgtcaaggccatataggttatcata |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43755753 |
caccggaaacatttgatcatatttaagtattcttttcttcaaattagtcgtgtttacgagtcattgttagcgtcgtgtcaaggccatataggttatcata |
43755852 |
T |
 |
| Q |
316 |
ttattgttgttggcattgatatttt |
340 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43755853 |
ttattgttgttggcattgatatttt |
43755877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University