View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20726_low_12 (Length: 254)

Name: NF20726_low_12
Description: NF20726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20726_low_12
NF20726_low_12
[»] chr3 (1 HSPs)
chr3 (16-132)||(20360975-20361092)
[»] chr4 (1 HSPs)
chr4 (187-245)||(25869576-25869634)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 16 - 132
Target Start/End: Original strand, 20360975 - 20361092
Alignment:
16 attccaactgcatccacatgggtttcttgcctaaaatccccaactttaattttgtgccatactctt-tcttacatggaggctaattcttcaatcaatatt 114  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||| |||||||||||||||||||    
20360975 attccaactgcactcacatgggtttcttgcctaaaatccccaactttaattttgtgccatactcttatcttatatgcaggttaattcttcaatcaatatt 20361074  T
115 ttctttgacagtaaagaa 132  Q
    |||||| ||| |||||||    
20361075 ttcttttacaataaagaa 20361092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 245
Target Start/End: Original strand, 25869576 - 25869634
Alignment:
187 agaatcaaacataaaactttaaggaaaaacacactttcagatctcaagtcaataccatc 245  Q
    |||||| ||||||| ||||| ||||  | |||||| |||||||||||||||||||||||    
25869576 agaatcgaacataagactttgaggaggagcacactctcagatctcaagtcaataccatc 25869634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University