View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20726_low_12 (Length: 254)
Name: NF20726_low_12
Description: NF20726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20726_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 16 - 132
Target Start/End: Original strand, 20360975 - 20361092
Alignment:
| Q |
16 |
attccaactgcatccacatgggtttcttgcctaaaatccccaactttaattttgtgccatactctt-tcttacatggaggctaattcttcaatcaatatt |
114 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
20360975 |
attccaactgcactcacatgggtttcttgcctaaaatccccaactttaattttgtgccatactcttatcttatatgcaggttaattcttcaatcaatatt |
20361074 |
T |
 |
| Q |
115 |
ttctttgacagtaaagaa |
132 |
Q |
| |
|
|||||| ||| ||||||| |
|
|
| T |
20361075 |
ttcttttacaataaagaa |
20361092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 245
Target Start/End: Original strand, 25869576 - 25869634
Alignment:
| Q |
187 |
agaatcaaacataaaactttaaggaaaaacacactttcagatctcaagtcaataccatc |
245 |
Q |
| |
|
|||||| ||||||| ||||| |||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
25869576 |
agaatcgaacataagactttgaggaggagcacactctcagatctcaagtcaataccatc |
25869634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University