View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20727_low_4 (Length: 227)
Name: NF20727_low_4
Description: NF20727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20727_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 10598822 - 10599048
Alignment:
| Q |
1 |
tcatcaggtttcacacctgttttgagcatatcatagaacaattctagtgcttttgtagcaaacccatgttttgcaaaaccatttatgatagaggtccaag |
100 |
Q |
| |
|
|||| ||| ||||||||||||| ||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10598822 |
tcattaggcttcacacctgtttcaagcatattatagaacaattctagtgcttttgaagcaaatccatgttttgcaaaaccatttatgatagaggtccaag |
10598921 |
T |
 |
| Q |
101 |
ttatgacattgcgatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttagaatacatagagatcaaagcattattaacacttag |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10598922 |
ttatgacattgcaatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttggaatacatagagatcaaagcattattaacacttaa |
10599021 |
T |
 |
| Q |
201 |
gtcagtccgaaatcccatcttcaccac |
227 |
Q |
| |
|
||||||||||||||| ||||| ||||| |
|
|
| T |
10599022 |
gtcagtccgaaatccaatcttaaccac |
10599048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University