View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20727_low_5 (Length: 212)
Name: NF20727_low_5
Description: NF20727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20727_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 8860263 - 8860069
Alignment:
| Q |
1 |
tatggtcgcaattttatgttctattcctagcttagcaatatcatcaaacctcatatgtatgtagtacactttctctattcaaattttgatttttattata |
100 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8860263 |
tatggtcgcaactttgtgttctattcctagcttagcaatatcatcaaacctcacatatatgtagtacactttctctattcaaattttgatttttattata |
8860164 |
T |
 |
| Q |
101 |
ctccattcctccttcttctaagtcaagtaaaaactagccctaactttctgccctaatcttgcattttccttcattatgttttcttgtgcatggat |
195 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8860163 |
ctccattcctccctcttctaagtcaagtaaaaactagccctaactttctgccctaatcttgcattttccttcattatgttttcttgtgcatggat |
8860069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University