View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20728_high_10 (Length: 233)
Name: NF20728_high_10
Description: NF20728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20728_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 218
Target Start/End: Complemental strand, 34375653 - 34375448
Alignment:
| Q |
14 |
aacctgtgacggtatcctt-atcttcttgcctgtaacggtggttgtaggaaaaagttaataaacataataatattacttgtatagtagttactatagtat |
112 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34375653 |
aacctgtgacgatatcctttatcttcttgcctgtaacggtggttgtaggaaaaagttaataaacataataatattacttgtatagtagttactatagtat |
34375554 |
T |
 |
| Q |
113 |
tactattacacatcgaaaaagacaattttttctgtcttactttcctttatactataaccaattctgattcccactcccccacaggccacatggtttgtga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34375553 |
tactattacacatcgaaaaagacaattttttctgtcttactttcctttatactataaccaattctgattcccactcccccacaggccacatggtttttga |
34375454 |
T |
 |
| Q |
213 |
tgtttc |
218 |
Q |
| |
|
|||||| |
|
|
| T |
34375453 |
tgtttc |
34375448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University