View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20728_low_4 (Length: 461)
Name: NF20728_low_4
Description: NF20728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20728_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 445; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 2 - 450
Target Start/End: Original strand, 1565034 - 1565482
Alignment:
| Q |
2 |
cgccttcgagtctgtcatgctctcctacaaatacttcaacttttctgcacggtccatcgctaacgattccacggaagaagataggaattctcgatgatgt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1565034 |
cgccttcgagtctgtcatgctctcctacaaatacttcaacttttctgcacggtccatcgctaacgattccacggaagaagataggaattcttgatgatgt |
1565133 |
T |
|
| Q |
102 |
tcgttctaatggttggcttgatgcaatgagatcatcgtctcctactcacaagaaaatatctatggatattggtcatggtgttgcatcttctgaagctgat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1565134 |
tcgttctaatggttggcttgatgcaatgagatcatcgtctcctactcacaagaaaatatctatggatattggtcatggtgttgcatcttctgaagctgat |
1565233 |
T |
|
| Q |
202 |
gctgcttatttaacctggctggtatgaaacacatactagtactaactctatgtaatttgttgtggaagttcggtttgcgcagtttccttattcgtttcct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1565234 |
gctgcttatttaacctggctggtatgaaacacatactagtactaactctatgtaatttgttgtggaagttcggtttgcgcagtttccttattcgtttcct |
1565333 |
T |
|
| Q |
302 |
cttttataatttttgcagctagagtttccatcagcaattggggccttcgaacaaattactaatcttgctaaaggcaagaaaatagcactgtttcttgatt |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1565334 |
cttttataatttttgcagctagagtttccatcagcaattggggccttcgaacaaattactaatcttgctaaaggcaagaaaatagcactgtttcttgatt |
1565433 |
T |
|
| Q |
402 |
acgatgggactctttcgccaattgttgacaatcctgagcgtgctttcat |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1565434 |
acgatgggactctttcgccaattgttgacaatcctgagcgtgctttcat |
1565482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University