View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20728_low_7 (Length: 344)
Name: NF20728_low_7
Description: NF20728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20728_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 3751128 - 3751365
Alignment:
| Q |
1 |
atttacattaagtccggatgaatatgaattggtcttaatcttttgtcgtgagatcacaaataaaaaataaaaggatttcatgtaatcatttatagtcgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3751128 |
atttacattaagtccggatgaatatgaattggtcttaatattttgtcgtgagatcacaaatcaaaaataaaaggatttcatgtaatcatttatagtcgca |
3751227 |
T |
|
| Q |
101 |
tagtaaataatctcaatagatgacaaatatcaaacaattgaaattgtgattttttaatttgcc------taattcgagtcatttgatctctatccaacaa |
194 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3751228 |
tagtaaataatttcaatagatgacgaatatcaaacaattgaaattatgattttttaatttgccgaattataattcgagtcatttgatctctatccaacaa |
3751327 |
T |
|
| Q |
195 |
caaaaatcgcacaatctaacaccaatgaaccatagaca |
232 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3751328 |
caaaaatcgcacgatctaacaccaatgaaccatagaca |
3751365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 225 - 327
Target Start/End: Complemental strand, 3750531 - 3750429
Alignment:
| Q |
225 |
catagacaacattaattttaaaaataatagaatatgaactctttttatcaaataaaaatttatattattggaggattgagacattgtcttggactcttgc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3750531 |
catagacaacattaattttaaaaataatagaatatgaactctttttatcaaataaaaatttatattattggaggattgagacattgtcttggactcttgc |
3750432 |
T |
|
| Q |
325 |
tgg |
327 |
Q |
| |
|
||| |
|
|
| T |
3750431 |
tgg |
3750429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University