View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20729_high_6 (Length: 357)
Name: NF20729_high_6
Description: NF20729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20729_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 20 - 347
Target Start/End: Original strand, 29422866 - 29423193
Alignment:
| Q |
20 |
gacatcatcaaatctggatcaggtgaatgcgttgccggttgttggagaatttgtgaatgacagcctccctgtagttgagtcggaaagttcatttagtcaa |
119 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29422866 |
gacatcctcgaatctggatcaggtgaatgcgttgccggttgttggagaatttgtgaatgacagcctccctgtagttgagtcggaaagttcatttagtcaa |
29422965 |
T |
|
| Q |
120 |
ggtaaatacttggtttatgtgggtggtggagataggtgtaagagcatgaatcatttcttgtggagtttcttgtgtgctctaggagaagctcagtacctaa |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29422966 |
ggtaagtacttggtttatgtgggtggtggagataggtgtaagagcatgaatcatttcttgtggagtttcttgtgtgctctaggagaagctcagtacctaa |
29423065 |
T |
|
| Q |
220 |
accgaacattggttatggatttgagcatatgtctgtcttcgatttacacttcatcgaagcaggatgaggaaggcaaagattttagattttactttgattt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29423066 |
accgaacattggttatggatttgagcatatgtctgtcttcgatttacacttcatcgaagcaggatgaggaaggcaaagattttaggttttactttgattt |
29423165 |
T |
|
| Q |
320 |
tgagcatttgaaggaggcggcgtctgtg |
347 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29423166 |
tgagcatttgaaggaggcggcgtctgtg |
29423193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 35558920 - 35558866
Alignment:
| Q |
282 |
gatgaggaaggcaaagattttagattttactttgattttgagcatttgaaggagg |
336 |
Q |
| |
|
||||| ||||| || |||||||| | ||||||||||||||| ||||||||||||| |
|
|
| T |
35558920 |
gatgaagaagggaaggattttaggtattactttgattttgaacatttgaaggagg |
35558866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University