View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2072_low_4 (Length: 228)
Name: NF2072_low_4
Description: NF2072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2072_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 43180815 - 43180616
Alignment:
| Q |
14 |
cagagacgtaaacgaaacctaattctccagattcaaccaccgtcatcgtagaaaggttcaaaagcgctaccaccagccccagtgccgtctttgccagctc |
113 |
Q |
| |
|
|||| ||||||| | |||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| ||| |||| |
|
|
| T |
43180815 |
cagaaacgtaaatggaacctaattctccatattccaccaccgtcatcgtagaaaagttcaaaagcgctaccaccagccccagcgccgtcttcgccggctc |
43180716 |
T |
|
| Q |
114 |
catcatcaccggctccacgaagaacgatgacagggttgaaaggtgaatgactactagcatcacgacggcgtcggcggaagccttgtcgacgggaagaaac |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43180715 |
catcatcaccggctctacgaagaacgatgacagggttgaaaggtgaatgactactagcatcacgacggcgtcggcggaagccttgtcaacgggaagaaac |
43180616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 51 - 213
Target Start/End: Original strand, 24097936 - 24098098
Alignment:
| Q |
51 |
caccgtcatcgtagaaaggttcaaaagcgctaccaccagccccagtgccgtctttgccagctccatcatcaccggctccacgaagaacgatgacagggtt |
150 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||| |||||||| || ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24097936 |
caccgtcatcgtagaaaagttcaaaagcgctaccaccagcaccagcgccgtcttctccgactccatcatcaccggctccacgaagaacgatgacaggatt |
24098035 |
T |
|
| Q |
151 |
gaaaggtgaatgactactagcatcacgacggcgtcggcggaagccttgtcgacgggaagaaac |
213 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| ||||||||||||||||| || |||||||| |
|
|
| T |
24098036 |
gaaaggtgaacgactaccagcgtcacgacggcgacggcggaagccttgtcggcgagaagaaac |
24098098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University