View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_high_105 (Length: 224)
Name: NF20730_high_105
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_high_105 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 47888114 - 47887905
Alignment:
| Q |
1 |
caaaaacacgtgtctttcaatatttttgcagccatgcgttctagataatagtcttaacctgaattgattggagagccattggagttgaacgtgttggagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47888114 |
caaaaacacgtgtctttcaatatttttgcagccatgcattctagataatagtcttaacctgaattgattggagagccattggagttgaacgtgttggagc |
47888015 |
T |
 |
| Q |
101 |
aacatctgagaccactagaacaacatctcctttgttgattaatcctttagatttcataagctgaacagattttgagatatttgattcagcatcatctgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47888014 |
aacatctgagaccactagaacaacatctcctttgttgattaatcctttagatttcataagctgaacagattttgagatatttgattcagcatcatctgat |
47887915 |
T |
 |
| Q |
201 |
aaatcaacaa |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
47887914 |
aaatcaacaa |
47887905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 6 - 101
Target Start/End: Complemental strand, 47889792 - 47889697
Alignment:
| Q |
6 |
acacgtgtctttcaatatttttgcagccatgcgttctagataatagtcttaacctgaattgattggagagccattggagttgaacgtgttggagca |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||| || ||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47889792 |
acacatgtctttcaatatttttgcagccatgcattctagataatggttttaacttgaattgattggagagccattggagtagaacgtgttggagca |
47889697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University