View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_high_31 (Length: 410)
Name: NF20730_high_31
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_high_31 |
 | |
|
| [»] scaffold0179 (5 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 81; Significance: 5e-38; HSPs: 5)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 2159 - 2251
Alignment:
| Q |
1 |
atggagagtttttattgtctgtgaggttcactttcattgctggggtagcaattatgctgcagaagctacagttattagcccctaaaccaaatt |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2159 |
atggacagtttttattgtctgtgaggttcactttcattgttggggtagcaattatgctgcagaaggtacagttattagcccctaaaccaaatt |
2251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 103 - 203
Target Start/End: Original strand, 2297 - 2397
Alignment:
| Q |
103 |
gttatttaggtaggggagggtccaggtgagaggcaataaaacagtggttagtctctctggttattctctcctgaactggttagcagttaaggttcccggt |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2297 |
gttatttaggtaggggagggtctaggtgagagccattaaaaaagtggttagtctctctggttattctctcctgaactgattagcagttaaggttcccggt |
2396 |
T |
|
| Q |
203 |
t |
203 |
Q |
| |
|
| |
|
|
| T |
2397 |
t |
2397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 332
Target Start/End: Original strand, 2396 - 2451
Alignment:
| Q |
277 |
ttaacaggggaggttacttgcgaaaggtggaccaacatgatttcaaaggacatttt |
332 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
2396 |
ttaacaggggaggttacttgcaaaaggtggaccaacatgttttcaaaggacatttt |
2451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 361 - 400
Target Start/End: Original strand, 2456 - 2495
Alignment:
| Q |
361 |
tagaatataagctagcaggatttcatgtttttcgcctatg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2456 |
tagaatataagctagcaggatttcatgtttttcgcttatg |
2495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 329 - 364
Target Start/End: Original strand, 2484 - 2519
Alignment:
| Q |
329 |
ttttcgcttatggttctgttgtgatcttgtgataga |
364 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2484 |
ttttcgcttatggttctgttgtgattttgtgataga |
2519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University