View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_high_45 (Length: 354)
Name: NF20730_high_45
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_high_45 |
 | |
|
| [»] scaffold0867 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 6e-59; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 22082540 - 22082687
Alignment:
| Q |
1 |
gtgtggcaatgtggctatgattgtgttcttactcttgatgagtttatgctaattaggttgcctctatagcaagcttgattgtgtttcaatata-atgcat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | | || |
|
|
| T |
22082540 |
gtgtggcaatgtggctatgattgtgttcttactcttgatgagtttatgataattaggttgcctctatagcaagcttgattgtgtttcaatgcatgttaat |
22082639 |
T |
|
| Q |
100 |
gttattataatcacattgaacgaaaaagtcatcagctgcaactcatat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22082640 |
gttattataatcacattgaacgaaaaagtcatcagctgcaactcatat |
22082687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 252 - 309
Target Start/End: Original strand, 22071834 - 22071891
Alignment:
| Q |
252 |
attgcactcttgttcttcccgggtgttaaaattgtttatgatgttggcttcgccatat |
309 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22071834 |
attgcattcttgttcttctggggtgttaaaattgtttatgatgttggcttggccatat |
22071891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 203 - 242
Target Start/End: Original strand, 22065824 - 22065863
Alignment:
| Q |
203 |
tttctatttttgatatatcatgtaaaatgatagttattag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22065824 |
tttctatttttgatatatcatgtaaaatgatagttattag |
22065863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 247
Target Start/End: Original strand, 22082774 - 22082813
Alignment:
| Q |
208 |
atttttgatatatcatgtaaaatgatagttattagtttat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22082774 |
atttttgatatatcatgtaaaatgatagttattagtttat |
22082813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 79
Target Start/End: Original strand, 22065282 - 22065361
Alignment:
| Q |
2 |
tgtggcaatgtggct--atgattgtgttcttactcttgatgagtttatgctaattaggttgcctctatagcaagcttgat |
79 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||| |||||||| ||||||| | ||||||||| | ||||||||||| |
|
|
| T |
22065282 |
tgtggcaatgtggctctatgattgcattcctactctttatgagtttttgctaataatgttgcctctttggcaagcttgat |
22065361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0867 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0867
Description:
Target: scaffold0867; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 79
Target Start/End: Complemental strand, 4061 - 3994
Alignment:
| Q |
12 |
tggctatgattgtgttcttactcttgatgagtttatgctaattaggttgcctctatagcaagcttgat |
79 |
Q |
| |
|
|||||||||||||| || || |||| ||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
4061 |
tggctatgattgtgatcgtaatcttaatgagttatggctaattaggttgcctctatggcaagcttgat |
3994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University