View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_high_48 (Length: 330)
Name: NF20730_high_48
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_high_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 44259379 - 44259555
Alignment:
| Q |
18 |
catcatgggccttacaccttcttttacctgcttcaagcttcttgatgggactttcagcttggatggtgtgggctgctggtggctttcatagagatctaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44259379 |
catcatgggccttacaccttcttttaccttcttcaagcttcttgatgggactttcagcttggatggtgtgggctgctggtggctttcatagagatctaac |
44259478 |
T |
 |
| Q |
118 |
tgctcttttgctttacttgcttcagattctatacactgtcttgtggaaccctcttgtttttagatttggggcaacga |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44259479 |
tgctcttttgctttacttgcttcagattctatacactgtcttgtggaaccctcttgtttttagatttggggcaacga |
44259555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 257 - 319
Target Start/End: Original strand, 44259618 - 44259680
Alignment:
| Q |
257 |
aagaaagttaatcctgttgctgctaatttgataaagccttgtttggctttgattgcttttctt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44259618 |
aagaaagttaatcctgttgctgctaatttgataaagccttgtttggctttgattgcttttctt |
44259680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University