View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_high_67 (Length: 266)
Name: NF20730_high_67
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_high_67 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 20 - 125
Target Start/End: Complemental strand, 41831273 - 41831168
Alignment:
| Q |
20 |
atatatatatgtatgtatgaaagaattaatacaagctttctaattaagatagctagtaagatacgaaaacatgatattccatgagacaatcccgcactat |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41831273 |
atatatatatatatgtatgaaagaattaatacaagctttctaattaagatagctagtaagatacgaaaacatgatattccatgagacaatcccgcactat |
41831174 |
T |
 |
| Q |
120 |
tatcca |
125 |
Q |
| |
|
|||||| |
|
|
| T |
41831173 |
tatcca |
41831168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University