View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20730_high_67 (Length: 266)

Name: NF20730_high_67
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20730_high_67
NF20730_high_67
[»] chr2 (1 HSPs)
chr2 (20-125)||(41831168-41831273)


Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 20 - 125
Target Start/End: Complemental strand, 41831273 - 41831168
Alignment:
20 atatatatatgtatgtatgaaagaattaatacaagctttctaattaagatagctagtaagatacgaaaacatgatattccatgagacaatcccgcactat 119  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41831273 atatatatatatatgtatgaaagaattaatacaagctttctaattaagatagctagtaagatacgaaaacatgatattccatgagacaatcccgcactat 41831174  T
120 tatcca 125  Q
    ||||||    
41831173 tatcca 41831168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University