View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_high_75 (Length: 251)
Name: NF20730_high_75
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_high_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 102 - 226
Target Start/End: Original strand, 21286111 - 21286235
Alignment:
| Q |
102 |
atccaatatttctatttataacaaatagattcactatatcctttcttctatatgaatcgattcatatgaacgannnnnnnataaaatgtaaaaattccta |
201 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21286111 |
atccaatatttctgtttacaacaaatagattcacaatatcctttcttctatatgaatcgattcatatgaacgatttttttataaaatgtaaaaattccta |
21286210 |
T |
 |
| Q |
202 |
tataacccaagactttagataaaaa |
226 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
21286211 |
tataacccaagactttacataaaaa |
21286235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 21286080 - 21286113
Alignment:
| Q |
1 |
tatttgattagaatgaataacgaaacgattcatc |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21286080 |
tatttgattagaatgaataacgaaacgattcatc |
21286113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University