View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_high_92 (Length: 241)
Name: NF20730_high_92
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_high_92 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 51 - 226
Target Start/End: Complemental strand, 52085848 - 52085664
Alignment:
| Q |
51 |
atttagacctagtttaggaaccaaccatgacacatacaggagtatatagattgcggtattagggcnnnnnnnnn---------gtagacgatgaccgtat |
141 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52085848 |
atttagacctaatttaggaaccaaccataacacatacaggagtatatagattgcggtattagggtttcttttctttcttttttgtagacgatgaccgtat |
52085749 |
T |
|
| Q |
142 |
tagggtattagagttttaccacacatcaccgatttcatattcacaataaaactgatcgttacaagaaaaaacaatggcagcatat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
52085748 |
tagggtattagagttttaccacacatcaccgatttcatattcacaataaaactgatcggtacaagaaaaaacaatggcagaatat |
52085664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 52085879 - 52085850
Alignment:
| Q |
1 |
gataattgcatatcttatattgagagctat |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52085879 |
gataattgcatatcttatattgagagctat |
52085850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University