View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_high_95 (Length: 239)
Name: NF20730_high_95
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_high_95 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 1905996 - 1905787
Alignment:
| Q |
18 |
aagtcattcatgttaggatgtttttacataaaacaaatttgatgtaaaacacaattttcaaactttcatcacatatagtcaaagtt-----ggactcag- |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| | | |
|
|
| T |
1905996 |
aagtcattcatgttaggatgtttttacataaaacaaatttgatgtaaaacacaattttcaaactttcatcacatatagtccaagtttcataggaataaat |
1905897 |
T |
|
| Q |
112 |
caaaatcaattttaaggaagaaatcaaaatcctattggatcataggaaactcacgtttcataacccgtggccgtggtgtatcgacatacacacttcgagc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1905896 |
caaaatcaattttaaggaagaaatcaaaattctattggatcataggaaactcacgtttcataacccgtggccgtggtgcatcgacatacacacttcgagc |
1905797 |
T |
|
| Q |
212 |
tgaacgactt |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
1905796 |
tgaacgactt |
1905787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University