View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_high_98 (Length: 237)
Name: NF20730_high_98
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_high_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 112 - 218
Target Start/End: Complemental strand, 27325756 - 27325650
Alignment:
| Q |
112 |
acttcatgctaatgtgtttagtgtttagtttactcattatctttgcctccttgggaatataatcattctgagtgggactgttctagttgttaattttgtg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27325756 |
acttcatgctaatgtgtttagtgtttagtttactcattatctttgcctccttgggaatataatcattctgagtgggactgttctagttgttaattttgtg |
27325657 |
T |
|
| Q |
212 |
tgcaaac |
218 |
Q |
| |
|
||||||| |
|
|
| T |
27325656 |
tgcaaac |
27325650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 27325867 - 27325813
Alignment:
| Q |
1 |
aggaagttcagagtttggtgtggcactgatcaaagctccaaggtatcttctataa |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27325867 |
aggaagttcagagtttggtgtggcactgatcaaagctccaaggtatcttctataa |
27325813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University