View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_low_101 (Length: 236)
Name: NF20730_low_101
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_low_101 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 29929148 - 29929362
Alignment:
| Q |
1 |
cagttagctgggagtgtcaacaaaatactgagatttgagagtggatgtgcaagaaatcaggtgcagaagtggagaaatctagactagggatcatgtactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29929148 |
cagttagctgggagtgtcaacaaaatactgagatttgagagtggatgtgcaagaaatcaggtgcagacgtggagaaatctagactagggatcatgtactt |
29929247 |
T |
 |
| Q |
101 |
tcatcacatgattatattgttgtccataactaaaaggcatgagcaacaaatcaaatcttaccacagataccaaaaagcaataatccaaatttcaagcttc |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29929248 |
tcatcacatgattatattgttgcccataactaaaaggcatgagcaacaaatcaaatcttaccacagataccaaaaagcaataatccaaatttcaagcatc |
29929347 |
T |
 |
| Q |
201 |
atgaagtttgcaaat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29929348 |
atgaagtttgcaaat |
29929362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University