View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_low_103 (Length: 234)
Name: NF20730_low_103
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_low_103 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 8548015 - 8548160
Alignment:
| Q |
1 |
tgcattttgtcattctctcaggataaaatatctcggaatgaatagcattgctctttttataattgtaaaacactttttgcggtgaaatgattaggaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8548015 |
tgcattttgtcattctctcaggataaaatatctcgggatgaatagcattgccctttttataattgtaaaacacttcttgcggtgaaatgattaggaatga |
8548114 |
T |
|
| Q |
101 |
attaattcgtgattaaggccagagaagcaaacgtaatgatgactaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8548115 |
attaattcgtgattaaggccagagaagcaaacgtaatgatgactaa |
8548160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 141 - 234
Target Start/End: Complemental strand, 8548318 - 8548225
Alignment:
| Q |
141 |
gactaaaataagacaannnnnnnatagactaaaaacagaaaatgtttatatttgtaggatccaaatgtatatttaaacctctttttaatctata |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8548318 |
gactaaaataagacaatttttttatagactaaaaacagaaaatgtttatatttgtaggatccaaatgtatatttaaacctctatttaatctata |
8548225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University