View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_low_105 (Length: 227)
Name: NF20730_low_105
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_low_105 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 48494231 - 48494431
Alignment:
| Q |
10 |
tagataatactgcttgatttttgcatgaccatgtttattaatccatcccaccattgcacttgaaccaaccatctttccatctctagaaaatccaatcccc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48494231 |
tagataatactgcttgatttttgcatgaccatgtttattaatccatcccaccattgcacttgaaccaaccatctttccatctctagaaaatccaatcccc |
48494330 |
T |
|
| Q |
110 |
acccacccaactgtgtagggtgcagataatatgattgttgtggtatcaccattttttgtgtactgcaat-aaaacctcacgacattattagatgcaaagg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48494331 |
acccacccaactgtgtagggtgcagataatatgattgttgtggtatcaccattttttgtgtactgcaataaaaacctcacgacattattagatgcaaagg |
48494430 |
T |
|
| Q |
209 |
a |
209 |
Q |
| |
|
| |
|
|
| T |
48494431 |
a |
48494431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University