View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20730_low_105 (Length: 227)

Name: NF20730_low_105
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20730_low_105
NF20730_low_105
[»] chr7 (1 HSPs)
chr7 (10-209)||(48494231-48494431)


Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 48494231 - 48494431
Alignment:
10 tagataatactgcttgatttttgcatgaccatgtttattaatccatcccaccattgcacttgaaccaaccatctttccatctctagaaaatccaatcccc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48494231 tagataatactgcttgatttttgcatgaccatgtttattaatccatcccaccattgcacttgaaccaaccatctttccatctctagaaaatccaatcccc 48494330  T
110 acccacccaactgtgtagggtgcagataatatgattgttgtggtatcaccattttttgtgtactgcaat-aaaacctcacgacattattagatgcaaagg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
48494331 acccacccaactgtgtagggtgcagataatatgattgttgtggtatcaccattttttgtgtactgcaataaaaacctcacgacattattagatgcaaagg 48494430  T
209 a 209  Q
    |    
48494431 a 48494431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University