View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_low_55 (Length: 307)
Name: NF20730_low_55
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 135 - 293
Target Start/End: Complemental strand, 6811277 - 6811119
Alignment:
| Q |
135 |
gaggatgcgccagaagtcggaggacctcatcaggtgtcgttgagctgcaccttttccatttccgcaacaaacttcagtccaatgcttgtagccaaaagct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6811277 |
gaggatgcgccagaagtcggaggacctcatcaagcgtcgttgagctgcaccttttccatttccgcaacaaacttcagtccaatgcttgtagccaaaagct |
6811178 |
T |
|
| Q |
235 |
tctctgtgagcttgatttaactacacttttttctgtttgatcttctctatatggttttt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6811177 |
tctctgtgagcttgatttaactacacttttttctgtttgatcttctctgtatggttttt |
6811119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 6811401 - 6811342
Alignment:
| Q |
15 |
agacacaaaaacattttatgtgattttctcaactcagaggagattcggattatgtaatac |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6811401 |
agacacaaaaacattttatgtgattttctcaactcagaggagattcggattatgtaatac |
6811342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University