View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_low_71 (Length: 259)
Name: NF20730_low_71
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_low_71 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 47887814 - 47887557
Alignment:
| Q |
1 |
gagatagtaatgatgccatatatccatgttttgtgtaaacaaagatggcatccacaccaagtttgttggctgcagaca----------agcacaaaagga |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47887814 |
gagatagtaatgatgccatatatccatgttttgtgtaaacaaagatggcatccacaccaagtttgttggctgcagacagacacagacaagcacaaaagga |
47887715 |
T |
 |
| Q |
91 |
gtgaattcaataatctacttatgcagatttcataacaaggttaagtgtctatttgattttactgtggcaaaaatatattttgattcaattgattttaaag |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47887714 |
gtgaattcaataatctacttatgcagatttcataacaaggttaagtgtctatttgattttactgtgacaaaaatatattttgattcaattgattttaaag |
47887615 |
T |
 |
| Q |
191 |
agttgattttagttgaaagtgaatttaagataaatgatttatgtttggttatgttcat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887614 |
agttgattttagttgaaagtgaatttaagataaatgatttatgtttggttatgttcat |
47887557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University