View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20730_low_78 (Length: 251)
Name: NF20730_low_78
Description: NF20730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20730_low_78 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 44952279 - 44952510
Alignment:
| Q |
1 |
tgtccatatatgtgacacacaaaacaacataggagtgttgcatggtagcttctgacatcgtgaattaagtactgcctatgtcacttaggaattcccctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952279 |
tgtccatatatgtgacacacaaaacaacataggagt--tgcatggtagcttctgacatcgtgaattaagtactgcctatgtcacttaggaattcccctct |
44952376 |
T |
 |
| Q |
101 |
cattgttctcatgtgatccaacaaatagatccacatctagtgtgtttgtgttccccgcacttaggtttgtcaagatatgatgaccacttacacacacata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
44952377 |
cattgttctcatgtgatccaacaaatagatccacatctagtgtgtttgtgttccccacacttaggtttgtcaagatatgatgacca-ttaaacacacata |
44952475 |
T |
 |
| Q |
201 |
cttcactttgttcattggtcctaacacgggtcttg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952476 |
cttcactttgttcattggtcctaacacgggtcttg |
44952510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University