View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20731_high_16 (Length: 232)
Name: NF20731_high_16
Description: NF20731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20731_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 23279654 - 23279452
Alignment:
| Q |
14 |
ataatactgttacgtataggaatttgaacataccgctatttgccgcaatcttcaattacagcactaggttgtatttcttgtataagcctcagggctctag |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23279654 |
ataaaactgttacgtataggaatttgaacataccgctatttgccgcaatcttcaattacagcactaggttgtatttcttgtataagcctcagggctctag |
23279555 |
T |
 |
| Q |
114 |
ataattgctaattttggatctttcagtcaagcatatgctactaatgttctattttcttttaccttgaattttgtttagtaactttcattatatggttaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23279554 |
ataattgctaattttggatctttcagtccagcatatgctactaatgttctattttcttttacctcgaattttgtttagtaactttcattatatggttaat |
23279455 |
T |
 |
| Q |
214 |
ttg |
216 |
Q |
| |
|
||| |
|
|
| T |
23279454 |
ttg |
23279452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 14 - 119
Target Start/End: Original strand, 23400678 - 23400783
Alignment:
| Q |
14 |
ataatactgttacgtataggaatttgaacataccgctatttgccgcaatcttcaattacagcactaggttgtatttcttgtataagcctcagggctctag |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23400678 |
ataacactgttacgtataggaatttgaacataccgctattttccgcaatcttcaattacagcaccaggttgtatttcttgtataagcctcagggctctag |
23400777 |
T |
 |
| Q |
114 |
ataatt |
119 |
Q |
| |
|
|||||| |
|
|
| T |
23400778 |
ataatt |
23400783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University