View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20731_low_12 (Length: 251)
Name: NF20731_low_12
Description: NF20731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20731_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 130 - 240
Target Start/End: Complemental strand, 7902440 - 7902333
Alignment:
| Q |
130 |
ggtgttggtagttgggggaaattaagggtgttgggttgggttgggtggatgattaagacaatttctatgagactgcagttactgtcctagctaaacaaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7902440 |
ggtgttggtagttgggggaaattaagggtgttagta---gttggttggatgattaagacaatttctatgagactgcagttactatcctagctaaacaaat |
7902344 |
T |
 |
| Q |
230 |
gctctgtctct |
240 |
Q |
| |
|
||||||||||| |
|
|
| T |
7902343 |
gctctgtctct |
7902333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University